"1","143B","143B","143.98.2","Homo sapiens","Bone",,"Osteosarcoma","Female","Caucasian","13","Years","Juvenile","CRL-8303","ATCC","143B, 143.98.2, 143B PML BK TK, 143B/TK^(-)neo^(R), HOS, HTK, KHOS/NP, KHOS-240S, KHOS-312H, MNNG/HOS Cl 5"," 143B, HOS link not reported",NULL
"2","A172","A-172","A-172","Homo sapiens","Brain",,"Glioblastoma","Male","--","--",,"Unknown","88062428","ECACC","--","--",NULL
"3","A925L","A925L","A925L","Homo sapiens","Lung",,"Adenocarcinoma","--","--","--",,"--","--","--","--","--",NULL
"4","ABC11","ABC-11","ABC-11","Homo sapiens","Lung",,"Adenocarcinoma","Female","--","61","Years","Adult","--","--","--","--",NULL
"5","ALL1","ALL-1","ALL-1","Homo sapiens","Blood",,"Leukemia Acute","Female","--","7","Years","--","--","--","--","--",NULL
"6","ALLSIL","ALL-SIL","ALL-SIL","Homo sapiens","Blood",,"Leukemia","Male","--","17","Years","Juvenile","ACC 511","DSMZ","--","--",NULL
"7","ALLVG","ALL-VG","ALL-VG","Homo sapiens","Blood",,"Leukemia","--","--","--",,"--","--","--","--","DOI: https://doi.org/10.1016/j.cancergencyto.2008.05.001 - JW Goethe University",NULL
"8","ALLMIK","ALL/MIK","ALL/MIK","Homo sapiens","Blood",,"Adult B acute lymphoblastic leukemia","Female","--","74","Years","--","--","--","--","--",NULL
"9","AP1060","AP-1060","AP-1060","Homo sapiens","Blood",,"Acute promyelocytic leukemia","Male","--","45","Years","--","--","--","--","--",NULL
"10","AP217","AP-217","AP-217","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Male","--","42","Years","--","--","--","AP217, AP-217","--",NULL
"11","BE13","BE-13","BE-13","Homo sapiens","Blood",,"Leukemia","Female","--","4","Years","Juvenile","ACC 396","DSMZ","PEER, BE-13","--",NULL
"12","BV173","BV-173","BV-173","Homo sapiens","Blood",,"Leukemia","male","--","45","Years","Adult","ACC 20","DSMZ","--","--",NULL
"13","C10","C10","C10","Homo sapiens","Colon",,"Adenocarcinoma","Male","--","--",,"--","--","--","--","--",NULL
"14","CMLT1","CML-T1","CML-T1","Homo sapiens","Blood",,"Leukemia","Female","--","36","Years","Adult","ACC 7","DSMZ","--","--",NULL
"15","COST","COST","COST","Homo sapiens","Blood",,"Lymphoma Anaplastic Large Cell","Male","--","--",,"--","--","--","--","--",NULL
"16","CUTO2","CUTO-2","CUTO-2","Homo sapiens","Lung",,"Carcinoma Non-Small Cell","--","--","--",,"--","--","--","--","PMID: 24349229 - University of Colorado",NULL
"17","CUTO23","CUTO-23","CUTO-23","Homo sapiens","Lung",,"Lung adenocarcinoma","--","--","--",,"--","--","--","--","--",NULL
"18","CUTO3","CUTO-3","CUTO-3","Homo sapiens","Lung","Pleura","Adenocarcinoma","--","--","--",,"--","--","--","--","PMID: 24162815 - University of Colorado",NULL
"19","CUTO33","CUTO-33","CUTO-33","Homo sapiens","Lung",,"Lung adenocarcinoma","--","--","--",,"--","--","--","--","--",NULL
"20","D538MG","D-538MG","D-538MG","Homo sapiens","Brain",,"Glioma","--","--","--",,"--","--","--","--","--",NULL
"21","DEL","DEL","DEL","Homo sapiens","Blood","Effusion, Pleural","Histiocytosis","Male","--","12","Years","Juvenile","ACC 338","DSMZ","--","--",NULL
"22","DFCI032","DFCI032","DFCI032","Homo sapiens","Lung",,"Adenocarcinoma","Female","--","--",,"--","--","--","DFCI-032","--",NULL
"23","DKFZBT66","DKFZ-BT66","DKFZ-BT66","Homo sapiens","Brain",,"Astrocitoma","Male","--","--",,"--","--","--","--","--",NULL
"24","EM2","EM-2","EM-2","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Female","Caucasian","5","Years","Juvenile","ACC 135","DSMZ","EM-2, EM-3","--",NULL
"25","EOL1","EOL-1","EOL-1","Homo sapiens","Blood",,"Leukemia Acute Myelogenous","Male","Japanese","33","Years","Adult","RCB0641 ","RIKEN","EOL-1, EOL-3","--",NULL
"26","HCC2429","HCC2429","HCC2429","Homo sapiens","Lung",,"Carcinoma Non-Small Cell","Unknown","--","--",,"Unknown","--","UTSW","--","--",NULL
"27","HCC78","HCC78","HCC78","Homo sapiens","Lung",,"Adenocarcinoma","Male","--","65","Years","Adult","ACC 563","DSMZ","--","--",NULL
"28","HEC59","HEC-59","HEC-59","Homo sapiens","Uterus",,"Adenocarcinoma Endometrioid","Female","Japanese","--",,"Unknown","JCRB1120 ","JCRB","--","--",NULL
"29","HNT34","HNT-34","HNT-34","Homo sapiens","Blood",,"Leukemia Acute Myelogenous","Female","--","47","Years","Adult","ACC 600","DSMZ","--","--",NULL
"30","IMSM2","IMS-M2","IMS-M2","Homo sapiens","Blood",,"Adult acute myeloid leukemia","Female","--","59","Years","--","--","--","--","--",NULL
"31","JB6","JB6","JB6","Homo sapiens","Blood",,"Lymphoma Anaplastic Large Cell","Male","--","12","Years","--","--","--","JB-6, JB","--",NULL
"32","JK1","JK-1","JK-1","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Male","--","62","Years","Adult","ACC 347","DSMZ","--","--",NULL
"33","JURLMK2","JURL-MK2","JURL-MK2","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Male","--","73","Years","Adult","ACC532","DSMZ","JURL-MK1, JURL-MK2","--",NULL
"34","K562","K-562","K-562","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Female","--","53","Years","Adult","CCL-243","ATCC","DD, K-562, K-562/ADM, K-562/Adr, K-562/MTX-2, K-562/Vin, KO51, P2UR/K-562, PC-MDS, RM-10, RS-1, SAM-1, SPI-801, SPI-802, T-33, TI-1","--",NULL
"35","KARPAS299","KARPAS-299","KARPAS-299","Homo sapiens","Blood",,"Lymphoma Non-Hodgkins","Male","--","25","Years","Adult","6072604","ECACC","--","--",NULL
"36","KBM-5","KBM-5","KBM-5","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Female","--","67","Years","Adult","--","--","KBM5","BCR-ABL1 positive",NULL
"37","KBM7","KBM-7","KBM-7","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Unknown","--","--",,"Unknown","http://www.ncbi.nlm.nih.gov/pubmed/8609723","--","--","--",NULL
"38","KCL22","KCL-22","KCL-22","Homo sapiens","Blood",,"Leukemia","Female","--","32","Years","Adult","ACC 519","DSMZ","--","--",NULL
"39","KG1","KG-1","KG-1","Homo sapiens","Blood",,"Leukemia Acute Myelogenous","Male","Caucasian","59","Years","Adult","CCL-246","ATCC","KG-1, KG-1a, KG-1-B, KMT-2","--",NULL
"40","KH88 C2F8","KH88 C2F8","KH88 C2F8","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Female","--","69","Years","--","--","--","KH88, KH88-B4D6, KH88 subclone C2F8, C2F8","--",NULL
"41","KIJK","Ki-JK","Ki-JK","Homo sapiens","Blood",,"Lymphoma","Male","--","15","Years","Juvenile","JCRB1065 ","JCRB","--","--",NULL
"42","KM12","KM-12","KM-12","Homo sapiens","Colon",,"Adenocarcinoma","Unknown","--","--",,"Unknown","--","--","--","--",NULL
"43","KOPM28","KOPM-28","KOPM-28","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Female","--","64","Years","--","--","--","KOPM28, KOPM-28","--",NULL
"44","KT1","KT-1","KT-1","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Male","--","32","Years","--","--","--","KT1","BCR-ABL1 positive",NULL
"45","KU812","KU812","KU812","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Male","Japanese","38","Years","Adult","CRL-2099","ATCC","KU812, KU812F, KU812E","--",NULL
"46","KYO1","KYO-1","KYO-1","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Male","Japanese","22","Years","Adult","ACC 601","DSMZ","KYO-1, KPB-M15","--",NULL
"47","L82","L-82","L-82","Homo sapiens","Blood",,"Lymphoma Diffuse Large B Cell","Female","--","24","Years","Adult","ACC 597","DSMZ","--","--",NULL
"48","LAMA84","LAMA-84","LAMA-84","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Female","--","29","Years","Adult","ACC 168","DSMZ","LAMA-84, LAMA-87","--",NULL
"49","LC2AD","LC-2/ad","LC-2/ad","Homo sapiens","Lung",,"Adenocarcinoma","Female","Japanese","51","Years","Adult","94072247","ECACC","--","--",NULL
"50","LN18","LN-18","LN-18","Homo sapiens","Brain",,"Glioma","Male","Caucasian","65","Years","Adult","CRL-2610","ATCC","--","--",NULL
"51","M091","M0-91","M0-91","Homo sapiens","Blood",,"Leukemia Acute Myeloid","--","--","--",,"--","--","--","MO-91, MO91, M091","--",NULL
"52","MC3","MC3","MC3","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Female","--","50","Years","--","--","--","MC-3, MC3","--",NULL
"53","MEG01","MEG-01","MEG-01","Homo sapiens","Blood","Bone Marrow","Leukemia","Male","--","56","Years","Adult","CRL-2021","ATCC",,"Meg-01, MEG01, Meg01",NULL
"54","MEGA2","MEG-A2","MEG-A2","Homo sapiens","Blood",,"Leukemia","Unknown","--","--",,"Unknown","IFO50478 ","JCRB","--","--",NULL
"55","MEGJ","Meg-J","Meg-J","Homo sapiens","Blood",,"Acute megakaryoblastic leukemia","--","--","--",,"--","--","--","MEG-J, MegJ","--",NULL
"56","MOLM1","MOLM-1","MOLM-1","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Male","--","41","Years","--","--","--","MOLM1","BCR-ABL1 positive",NULL
"57","MOLM16","MOLM-16","MOLM-16","Homo sapiens","Blood",,"Leukemia Acute Myelogenous","Female","Japanese","77","Years","Adult","ACC 555","DSMZ","--","--",NULL
"58","MOLM7","MOLM-7","MOLM-7","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Male","--","44","Years","--","--","--","MOLM-6, MOLM-8, MOLM-9, MOLM-10, MOLM-11, MOLM-12 ","BCR-ABL1 positive",NULL
"59","MYL","MYL","MYL","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Female","--","24","Years","--","--","--","--","BCR-ABL1 positive",NULL
"60","MyLa","MyLa","MyLa","Homo sapiens","Skin",,"Lymphoma","--","--","--",,"--","--","--","MyLa 1850, MyLa 1885, MyLa 1928, MyLa 1929, MyLa 2000, MyLa 2039, MyLa 2059, MyLa 2355, MyLa 3241, MyLa 3675","--",NULL
"61","NALM1","NALM-1","NALM-1","Homo sapiens","Blood",,"Leukemia Chronic Myelogenous","Female","--","3","Years","Juvenile","ACC 131","DSMZ","--","--",NULL
"62","NALM24","NALM-24","NALM-24","Homo sapiens","Blood",,"Adult B acute lymphoblastic leukemia","Female","--","42","Years","--","--","--","NALM24, B262, NALM-25, NALM25","--",NULL
"63","NCIH2228","NCI-H2228","NCI-H2228","Homo sapiens","Lung",,"Carcinoma Non-Small Cell","Female","--","--",,"Unknown","CRL-5935","ATCC","--","--",NULL
"64","NCIH3122","NCI-H3122","NCI-H3122","Homo sapiens","Lung",,"Adenocarcinoma","Unknown","--","--",,"Unknown","DFCI","DFCI"," H3122","--",NULL
"65","NSMEG","NS-Meg","NS-Meg","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Female","--","44","Years","--","--","--","NS-MEG","--",NULL
"66","OCIAML2","OCI-AML2","OCI-AML2","Homo sapiens","Blood",,"Leukemia Acute Myelogenous","Male","--","65","Years","Adult","ACC 99","DSMZ","--","--",NULL
"67","OCUBM","OCUB-M","OCUB-M","Homo sapiens","Breast","Effusion, Pleural","Unknown","Female","Japanese","53","Years","Adult","RCB0881","RIKEN","OCUB-1,OCUB-F, OCUB-M","--",NULL
"68","OCUM-8","OCUM-8","OCUM-8","Homo sapiens","Stomach",,"Diffuse gastric adenocarcinoma","Female","--","67","Years","--","--","--","OCUM8","--",NULL
"69","PANC0403","Panc 04.03","Panc 04.03","Homo sapiens","Pancreas",,"Adenocarcinoma","Male","Caucasian","70","Years","Adult","CRL-2555","ATCC","Panc 04.03, PANC-04-03, Panc_04_03, Panc04.03, Panc 4.03, PANC 4.03, Panc4.03, PANC0403, Panc0403, PANC403, Pa17C, Pa017C, PL 5, PL5, PL-5","--",NULL
"70","PER403","PER-403","PER-403","Homo sapiens",,,"Carcinoma","Female","--","11","Years","--","--","--","--","--",NULL
"71","PER624","PER-624","PER-624","Homo sapiens",,,"Carcinoma","Female","--","16","Years","--","--","--","--","--",NULL
"72","PL18","PL18","PL-18","Homo sapiens","Pancreas",,"Unknown","Unknown","--","--",,"Unknown","--","--","--","--",NULL
"73","RT112","RT-112","RT-112","Homo sapiens","Urinary Bladder",,"Carcinoma Transitional Cell","Female","--","--",,"Unknown","ACC 418","DSMZ","--","--",NULL
"74","RT4","RT4","RT4","Homo sapiens","Urinary Bladder",,"Carcinoma Transitional Cell","Male","Caucasian","63","Years","Adult","HTB-2","ATCC","--","--",NULL
"75","SBC3","SBC-3","SBC-3","Homo sapiens","Lung",,"Carcinoma Small Cell","Unknown","--","--",,"Unknown","JCRB0818 ","JCRB","--","--",NULL
"76","SD1","SD-1","SD-1","Homo sapiens","Blood",,"Leukemia Acute Lymphocytic","Female","--","--",,"Unknown","ACC 366","DSMZ","--","--",NULL
"77","SJGBM2","SJ-GBM2","SJ-GBM2","Homo sapiens","Brain",,"Glioblastoma","Female","Caucasian","50","months",,,,"SJ-G2, SJG2","--",NULL
"78","SK9","SK-9","SK-9","Homo sapiens","Blood",,"Acute Lymphoblastic leukemia","--","--","--",,"Adult","--","--","--","--",NULL
"79","SNU16","SNU-16","SNU-16","Homo sapiens","Stomach","Ascites","Carcinoma","Female","--","33","Years","Adult","CRL-5974","ATCC","--","--",NULL
"80","SNU2292","SNU-2292","SNU-2292","Homo sapiens","Lung",,"Lung adenocarcinoma","Female","--","39","Years","--","--","--","SNU2292","--",NULL
"81","SNU2535","SNU-2535","SNU-2535","Homo sapiens","Lung",,"Non-small cell lung carcinoma","Female","--","57","Years","--","--","--","SNU2535","--",NULL
"82","SR786","SR-786","SR-786","Homo sapiens","Blood",,"Lymphoma Anaplastic Large Cell","Male","--","11","Years","Juvenile","ACC 369","DSMZ","SR, SR-786","--",NULL
"83","STE1","STE-1","STE-1","Homo sapiens","Lung",,"Adenocarcinoma","--","--","--",,"--","--","--","--","PMID: 25173427 - Vanderbilt University",NULL
"84","SUDHL1","SU-DHL-1","SU-DHL-1","Homo sapiens","Blood",,"Lymphoma Non-Hodgkins","Male","--","10","Years","Juvenile","ACC 356","DSMZ","--","--",NULL
"85","SUPB15","SUP-B15","SUP-B15","Homo sapiens","Blood",,"Leukemia Acute Lymphocytic","Male","Caucasian","8","Years","Juvenile","CRL-1929","ATCC","--","--",NULL
"86","SUPM2","SUP-M2","SUP-M2","Homo sapiens","Blood",,"Lymphoma Diffuse Large B Cell","Female","--","5","Years","Juvenile","ACC 509","DSMZ","--","--",NULL
"87","SUPT13","SUP-T13","SUP-T13","Homo sapiens","Blood",,"Leukemia Acute Lymphocytic","Female","--","--",,"--","--","--","Sup-T13, SupT13, SUPT13, SUPT-13","--",NULL
"88","SW780","SW 780","SW 780","Homo sapiens","Urinary Bladder",,"Carcinoma Transitional Cell","Female","Caucasian","80","Years","Adult","CRL-2169","ATCC","--","--",NULL
"89","TALL104","TALL-104","TALL-104","Homo sapiens","Blood",,"Leukemia Acute Lymphocytic","Male","--","2","Years","Juvenile","CRL-11386","ATCC","--","--",NULL
"90","TK6","TK6","TK6","Homo sapiens","Blood",,"Normal","Male","Caucasian","5","Years","Juvenile","CRL-8015","ATCC","LTR228, SKW 6.4, TK6, WIL2-NS, WIL2-S, TK-6","--",NULL
"91","TMD5","TMD5","TMD5","Homo sapiens","Blood",,"Leukemia","Male","--","19","Years","Juvenile","IFO50516 ","JCRB","--","--",NULL
"92","TOM1","TOM-1","TOM-1","Homo sapiens","Blood",,"Leukemia","Female","--","54","Years","Adult","ACC 578","DSMZ","--","--",NULL
"93","TPC1","TPC-1","TPC-1","Homo sapiens","Thyroid",,"Carcinoma","Female","--","--",,"--","--","--","TPC1","--",NULL
"94","TS922","TS9;22","TS9;22","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Male","--","56","Years","--","--","--","TS9:22, TS9-22, TS 9:22","--",NULL
"95","TY82","Ty-82","Ty-82","Homo sapiens","Thymus",,"Carcinoma","Female","Japanese","22","Years","Adult","JCRB1330 ","JCRB","--","--",NULL
"96","U118MG","U-118 MG","U-118 MG","Homo sapiens","Brain",,"Glioblastoma","Male","Caucasian","50","Years","Adult","HTB-15","ATCC","U-118 MG, 1181N1, 1321N1, U-138 MG","--",NULL
"97","YAMN91","YAMN-91","YAMN-91","Homo sapiens","Blood",,"Leukemia","--","--","--",,"--","--","--","YAMN91","BCR-ABL1 positive",NULL
"98","YOSM","YOS-M","YOS-M","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Male","--","77","Years","--","--","--","YOS-B","--",NULL
"99","YS922","YS9;22","YS9;22","Homo sapiens","Blood",,"Chronic myelogenous leukemia","Female","--","23","Years","--","--","--","YS9:22, YS9-22, YS 9:22","--",NULL
"100","Z119","Z-119","Z-119","Homo sapiens","Blood",,"Adult B acute lymphoblastic leukemia","Female","--","25","Years","--","--","--","Z119","--",NULL
"101","Z181","Z-181","Z-181","Homo sapiens","Blood",,"Adult B acute lymphoblastic leukemia ","Male","--","33","Years","--","--","--","Z181","--",NULL
"102","Z33","Z-33","Z-33","Homo sapiens","Blood",,"Adult B acute lymphoblastic leukemia ","Female","--","53","Years","--","--","--","Z33","--",NULL
"103","AN3CA","AN3 CA","AN3 CA","Homo sapiens","Uterus",NULL,"Adenocarcinoma","Female","Caucasian","55","Years","Adult","HTB-111","ATCC","AN3_CA, AN3 CA, AN3 Ca, AN3CA, AN-3, AN3, Acanthosis Nigricans 3rd attempt-CArcinoma","--","--"
"104","MDAMB468","MDA-MB-468","MDA-MB-468","Homo sapiens","Breast",NULL,"Adenocarcinoma","Female","African","51","Years","Adult","HTB-132","ATCC","MDA-MB 468, MDA-MB468, MDAMB468, MDA-468, MDA468, MB468, MD Anderson-Metastatic Breast-468","--","--"
"105","SUM185PE","SUM 185PE","SUM 185PE","Homo sapiens",,"Anaplastic Carcinoma",NULL,"--","--","--",,"--","--","--","SUM-185PE, SUM 185PE, SUM-185, SUM 185, SUM185, 185PE","--","--"
"1","143B","143.98.2","143B, 143.98.2, 143B PML BK TK, 143B/TK^(-)neo^(R), HOS, HTK, KHOS/NP, KHOS-240S, KHOS-312H, MNNG/HOS Cl 5","Bone","TPR","MET","TPR","MET","MET","RECEPTOR TK","4233","P08581","NM_000245.3","NM_000245.3",,,"V1078-I1345",,"NM_003292.3","NM_003292.3","TPR-MET","1q31.1","7q31","4","15","1009","AGCCAATTTACAAGAACAAAGGAAGAATTAGAAGCTGAGAAAAGAGACTTAATTAGAACCAATGAGAGACTATCTCAAGAACTTGAATACTTAACAG","ATCAGTTTCCTAATTCATCTCAGAACGGTTCATGCCGACAAGTGCAGTATCCTCTGACAGACATGTCCCCCATCCTAACTAGTGGGGACTCTGATATATCCAGTCCATTACTGCAAAATACTGTCCACATTGACCTCAGTGCTCTAAATCCAGAGCTGGTCCAGGCAGTGCAGCATGTAGTGATTGGGCCCAGTAGCCTGATTGTGCATTTCAATGAAGTCATAGGAAGAG","523","translocation",,"RT-PCR, NGS","N",,"23637631, 8547307, 26210452",,NULL,NULL
"3","ALL/MIK","ALL/MIK","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511, 10766197, 7693103",,NULL,NULL
"4","ALL-SIL","ALL-SIL","--","Blood","NUP214","ABL1","NUP214","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_005085 ","NM_005085 ","NUP214-ABL1","9q34.13","9q34.12","32","2","26","ATACCTCTAACCTATTTGGAAACAGTGGGGCCAAGACATTTGGTGGATTTGCCAGCTCGTCGTTTGGAGAGCAGAAACCCACTGGCACTTTCAGCTCTGGAGGAGGAAGTGTGGCATCCCAAGGCTTTGGGTTTTCCTCTCCAAACAAAACAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","3071","scramble",,"FISH, Western blot, RT-PCR, NGS","Y","TCGA-L5-A4OQ-01A","23637631, 25120641, 18784740, 23872305, 15361874, 20073070, 24853389",,NULL,NULL
"5","AP-217","AP-217","AP217, AP-217","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511",,NULL,NULL
"6","BE-13","BE-13","PEER, BE-13","Blood","NUP214","ABL1","NUP214","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_005085 ","NM_005085 ","NUP214-ABL1","9q34.13","9q34.12","34","2","26","GTTTGGGAGCAGCAGCAACACCACATCCTTCGGCACGCTCGCGAGTCAGAATGCCCCCACTTTCGGATCACTGTCCCAACAGACTTCTGGTTTTGGGACCCAGAGTAGCGGATTCTCTGGTTTTGGATCAGGCACAGGAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","3175","scramble",,"FISH, Western blot, RT-PCR, NGS ","Y","TCGA-L5-A4OQ-01A","23637631, 25120641, 27821800, 15361874, 20073070, 27908728",,NULL,NULL
"7","BV173","BV-173","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"real-time PCR, RT-PCR, Sanger sequencing, Western blot, DNA-Based Looped Ligation Assay LOLA, FISH","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","26002693, 17497325, 10910048, 10576511, 28515100, 28017647, 20809971, 2194587, 27890856, 26087013, 10766197, 31349760",,NULL,NULL
"8","CML-T1","CML-T1","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR, FISH, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511, 20809971, 2788468, 10766197, 10910924, 16169003",,NULL,NULL
"9","D-538MG","D-538MG","--","Brain","BCL6","RAF1","BCL6","RAF1","RAF1","TKL","5894","P04049",,"NM_002880","NM_002880",,"V349-L609",,"NM_001706.5","NM_001706.5","BCL6-RAF1","3q27.3","3p25.2","8","8","278","GTGAGAAACCCTATCGTTGCAACATCTGTGGGGCCCAGTTCAACCGGCCAGCCAACCTGAAAACCCACACTCGAATTCACTCTGGAGAGAAGCCCTACAAATGCGAAACCTGCGGAGCCAGATTTGTACAG","GATGCAATTCGAAGTCACAGCGAATCAG","983","deletion",,"RT-PCR, NGS","N",,"23637631",,"Reference: hg38",NULL
"10","DKFZ-BT66","DKFZ-BT66","--","Brain","KIAA1549","BRAF","KIAA1549","BRAF","BRAF","TKL","673","P15056","NM_004333.5 ","NM_004333.5 ","NM_004333",,"I457-L717",,"NM_001164665.1","NM_001164665.1","KIAA1549-BRAF","7q34","7q34","16","9","380","TCGGATCCTGACCTCCCAGCCGATGTGCAGACACCATCCTCGGTGGAACTGGGGAGGTATCCAGCCCTTCCCTTCCCGGCCTCCCAGTACATCCCACCCCAGCCGTCCATCGAGGAGGCACGCCAGACCATGCACTCCCTCCTGGACGACGCCTTTGCCCTCGTGGCCCCCAGCAGCCAGCCTGCCAGCACCGCAGGTGTAGGCCCCGGAGTCCCACCCGGCCTGCCCGCAAACAGCACCCCTTCCCAGGAAGAGAGGCGAGCCACCCAGTGGGGGTCCTTCTACAGCCCAGCCCAGACGGCCAACAATCCCTGCAGT","GACTTGATTAGAGACCAAGGATTTCGTGGTGATGGAG","2135","scramble",,"real-time PCR","Y","TCGA-HT-7691-01A","28002790",,NULL,NULL
"11","EOL-1","EOL-1","EOL-1, EOL-3","Blood","FIP1L1","PDGFRA","FIP1L1","PDGFRA","PDGFRA","RECEPTOR TK","5156","P16234","NM_006206","NM_006206","NM_006206",,"L593-L954",,"NM_030917","NM_030917","FIP1L1-PDGFRA","4q12","4q12","12","12","551","GAGATTACCTGGGGCAATTGATGTTATCGGTCAGACTATAACTATCAGCCGAGTAGAAGGCAGGCGACGGGCAAATGAGAACAGCAACATACAG","AAACCGAGGTATGAAATTCGCTGGAGGGTCATTGAATCAATCAGCCCAGATGGACATGAATATATTTATGTGGACCCGATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGAGATGGACTAGTGCTTG","877","deletion",,"RT-PCR, NGS","N",,"23637631, 14630792, 29089259, 28802831",,NULL,NULL
"12","H3122","NCI-H3122","H3122","Lung","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4","NM_004304",,"I1116-V1392",,"NM_019063.4","NM_019063.4","EML4-ALK","2p21","2p23.2-p23.1","13","20","1057","AAATATGAAAAGCCAAAATTTGTGCAGTGTTTAGCATTCTTGGGGAATGGAGATGTTCTTACTGGAGACTCAGGTGGAGTCATGCTTATATGGAGCAAAACTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","1059","inversion",,"RT-PCR, Sanger sequencing, FISH, Western blot, NGS Garnett e articolo 2018, Immuno-DNA FISH assay, exon array","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","28850922, 18594010, 25173427, 21613408, 25581823, 26755435, 25301075, 24675041, 26459174, 26791794, 26585927, 28073897, 28740365, 27707887, 26639656, 26419961, 28370702, 28741662, 27119231, 27811184, 26992917, 26870817, 25502629, 27078848, 28450729, 25096400, 24853389, 24373969, 24419060, 24556908, 25193384, 24469055, 23788756, 23434628, 23443800, 24022839, 23533265, 23325296, 28181564, 29286485, 31097696, 29455675, 30115026, 29304828, 32164629, 33246076, 31654622",,NULL,NULL
"13","IMS-M2","IMS-M2","--","Blood","ETV6","NTRK3","ETV6","NTRK3","NTRK3","RECEPTOR TK","4916","Q16288","NM_001012338.2","NM_001012338.2",,,"I538-G839",,"NM_001987","NM_001987","ETV6-NTRK3","12p13.2","15q25.3","4","15","528","GTGATGTGCTCTATGAACTCCTTCAGCATATTCTGAAGCAGAGGAAACCTCGGATTCTTTTTTCACCATTCTTCCACCCTGGAAACTCTATACACACACAGCCGGAGGTCATACTGCATCAGAACCATGAAGAAG","ATGTGCAGCACATTAAGAGGAGAGACATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGCTACAACCTCAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAG","465","translocation",,"RT-PCR, Western blot, NGS","Y","TCGA-AO-A03U-01B, TCGA-CE-A27D-01A, TCGA-CK-5913-01A, TCGA-CK-5916-01A, TCGA-DJ-A3UV-01A, TCGA-DJ-A4V0-01A, TCGA-E8-A438-01A, TCGA-EB-A51B-01A, TCGA-EL-A3ZN-01A, TCGA-FE-A3PD-01A","29237803",,NULL,NULL
"14","KARPAS-299","KARPAS-299","--","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4","NM_004304",,"I1116-V1392",,"NM_002520.6","NM_002520.6","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"RT-PCR, Western blot, NGS","N",,"29045271, 3260522, 19147828, 23637631, 23153582, 24972969, 16049513, 10994999, 8187071, 27795556, 28675026, 25978431, 24218589, 25301075, 26258416, 27780853, 25359993, 26476082, 25533804, 26939704, 25820993, 25874976, 25421750, 26133723, 26018086, 26750252, 25193384, 24112608, 24149177, 23239810, 24386191, 28557340, 29581862, 31097696, 31804622, 32193476, 33140567, 30262555",,NULL,NULL
"15","KBM7","KBM-7","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","25997600, 8609723, 12015767, 10576511",,NULL,NULL
"16","KCL-22","KCL-22","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"Western blot, RT-PCR, PCR, FISH, Multiplex amplifiable probe hybridization MAPH ","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","26179066, 26087013, 21299849, 10576511, 28017647, 20809971, 15610007, 28556300, 27307395, 24070327, 24012109, 12759926, 29608815, 30049824, 31349760",,NULL,NULL
"17","KH88 C2F8","KH88 C2F8","KH88, KH88-B4D6, KH88 subclone C2F8, C2F8","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR,Westernblot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","27908728, 8289484, 10576511",,NULL,NULL
"18","KIJK","Ki-JK","--","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4","NM_004304",,"I1116-V1392",,"NM_002520.6","NM_002520.6","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"RT-PCR","N",,"28581487, 19147828, 10994999, 27795556, 28806414",,NULL,NULL
"19","KOPM-28","KOPM-28","KOPM28, KOPM-28","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511, 29967475",,NULL,NULL
"20","LAMA-84","LAMA-84","LAMA-84, LAMA-87","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR, Western blot, FISH","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","26179066, 26087013, 10688835, 10576511, 28017647, 20809971, 24070327, 24012109",,NULL,NULL
"21","LC-2/ad","LC-2/ad","--","Lung","CCDC6","RET","CCDC6","RET","RET","RECEPTOR TK","5979","P07949","NM_020975.5","NM_020975.5","NM_020975",,"L724-L1016",,"NM_005436.4","NM_005436.4","CCDC6-RET","10q21.2","10q11.21","1","12","712","AGTGCAATACTGCCCAAGCCCGGGCGGGGTCTCTGTTCTCTGGCAGAGGAGGTCCCTTGGCAGCGGGAAGCGCCCTCTCTTTCTCTCGCCGCCGCTCCGAGTCTGCGCCCTGGTGCCAGGCGCTCAGCTCGGCGCTCCCCTGTGCTCGCCCGGCGCCCACTCATTCGCAGCCCGGCCTTCGTCGCCGCCGCCTCCCTGCTGCTCCTCCTCCTTTCCCCAGCCCGCCGCGGCCATGGCGGACAGCGCCAGCGAGAGCGACACGGACGGGGCGGGGGGCAACAGCAGCAGCTCGGCCGCCATGCAGTCGTCCTGCTCGTCGACCTCGGGCGGCGGCGGTGGCGGCGGGGGAGGCGGCGGCGGTGGGAAGTCGGGGGGCATTGTCATCTCGCCGTTCCGCCTGGAGGAGCTCACCAACCGCCTGGCCTCGCTGCAGCAAGAGAACAAGGTGCTGAAGATAGAGCTGGAGACCTACAAACTGAAGTGCAAGGCACTGCAGGAGGAGAACCGCGACCTGCGCAAAGCCAGCGTGACCATC","GAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCTAGGAGAAGGCGAATTTGGAAAAGTGGTCAAGGCAACGGCCTTCCATCTGAAAGGCAGAGCAGGGTACACCACGGTGGCCGTGAAGATGCTGAAAG","503","inversion ",,"RT-PCR, Sanger sequecning, Western blot, NGS, RT-qPCR","Y","TCGA-BJ-A0ZJ-01A, TCGA-BJ-A28Z-01A, TCGA-CE-A13K-01A, TCGA-DJ-A3V3-01A, TCGA-DJ-A4UQ-01A, TCGA-DJ-A4V5-01A, TCGA-DO-A1JZ-01A, TCGA-E3-A3E0-01A, TCGA-EL-A3TB-01A, TCGA-EL-A3ZP-01A, TCGA-ET-A3DR-01A, TCGA-FK-A3SE-01A","27873490, 23154560, 23578175, 23637631, 26208525, 26459174, 28011461, 28073897, 25384172, 25349307, 28802831, 28615362, 30115026, 30943926",,NULL,NULL
"22","MEG01","MEG-01",,"Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"real-time PCR, RT-PCR, FISH, Western blot, Multiplex amplifiable probe hybridization MAPH ","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","26002693, 24691473, 10576511, 28017647, 20809971, 26202951, 26554155, 12759926, 28802831, 30049824, 31518872",,NULL,NULL
"23","Meg-J","Meg-J","MEG-J, MegJ","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","27908728, 10576511",,NULL,NULL
"24","NALM-24","NALM-24","NALM24, B262, NALM-25, NALM25","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511",,NULL,NULL
"25","NS-Meg","NS-Meg","NS-MEG","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511",,NULL,NULL
"26","OCUBM","OCUB-M","OCUB-1, OCUB-F, OCUB-M","Breast","RWDD1","ROS1","RWDD1","ROS1","ROS1","RECEPTOR TK","6098","P08922","NM_001378902.1","NM_001378902.1",,,"L1945-F2222",,"NM_015952","NM_015952","RWDD1-ROS1","6q22.1","6q22.1","1","20","932","CTCCCGGCGCGGCAGCTGTCTGGGCTGCTGCGCGCCGCCTAGGTGTCTGGGCGATCTATGGGCAAGAGCAAGGGCCACGATGACAGATTACGGCGAGGAGCAGCGCAACGAGCTGGAGGCCCTGGAGTCCATCTACCCTGACTCCTTCACAG","GGAACTTTTCCTTTACCCCTAAGGTTATTCCAGATTCTGTTCAAGAGTCTTCATTTAGGATTGAAGGAAATGCTTCAAGTTTTCAAATCCTGTGGAATGGTCCCCCTGCGGTAGACTGGGGTGTAGTTTTCTACAGTGTAGAATTTAGTGCTCATTCTAAG","1433","inversion",,"RT-PCR , Sanger, FISH, NGS","N",,"31097696",,"Reference: hg38",NULL
"27","PL-5","Panc 04.03","Panc 04.03, PANC-04-03, Panc_04_03, Panc04.03, Panc 4.03, PANC 4.03, Panc4.03, PANC0403, Panc0403, PANC403, Pa17C, Pa017C, PL 5, PL5, PL-5","Pancreas","ATG7","RAF1","ATG7","RAF1","RAF1","TKL","5894","P04049",,"NM_002880","NM_002880",,"V349-L609",,"NM_006395.2","NM_006395.2","ATG7-RAF1","3p25.3","3p25.2","17","8","278","ATCCGGGGATTTCTTTCACGGTTTGATAATGTCCTTCCCGTCAGCCTGGCATTTGACAAATGTACAGCTTGTTCTTCCAAA","GATGCAATTCGAAGTCACAGCGAATCAG","1022","inversion",,"RT-PCR, NGS","N",,"23637631",,NULL,NULL
"28","SD-1","SD-1","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"real-time PCR, PCR, RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","26002693, 10910048, 21299849, 10576511, 10766197, 31349760",,NULL,NULL
"29","SK-9","SK-9","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","28556300, 20471447, 32203161",,NULL,NULL
"30","SNU-16","SNU-16","--","Stomach","APIP","FGFR2","APIP","FGFR2","FGFR2","RECEPTOR TK","2263","P21802","NM_000141.4","NM_000141.4","NM_001144916, NM_000141",,"L481-L770",,"NM_015957.3","NM_015957.3","APIP-FGFR2","11p13","10q26.13","1","6","208","GCCCCGCCCCCGGGCTGCCCTCAGCGCCGCCTGATTGCATTTGCGGCCTCGCTGCCGTATCCCAGGCTAAGCGCCGCGCGCAAAGCCGTGCGGAGATTGGAGGCCGCGCGGGTCCCTGGTCTGGGCCATGTCTGGCTGTGATGCTCGGGAGGGAGACTGTTGTTCCCGGAGATGCGGCGCGCAG","GTACGAAACCAGCACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACCTGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGTTGTGG","632","translocation",,"RT-PCR, Sanger sequencing","N",,"28123544",,NULL,NULL
"31","SNU-16","SNU-16","--","Stomach","APIP","FGFR2","APIP","FGFR2","FGFR2","RECEPTOR TK","2263","P21802","NM_000141.4","NM_000141.4","NM_001144916, NM_000141",,"L481-L770",,"NM_015957.3","NM_015957.3","APIP-FGFR2","11p13","10q26.13","1","10","429","GCCCCGCCCCCGGGCTGCCCTCAGCGCCGCCTGATTGCATTTGCGGCCTCGCTGCCGTATCCCAGGCTAAGCGCCGCGCGCAAAGCCGTGCGGAGATTGGAGGCCGCGCGGGTCCCTGGTCTGGGCCATGTCTGGCTGTGATGCTCGGGAGGGAGACTGTTGTTCCCGGAGATGCGGCGCGCAG","GTTTCGGCTGAGTCCAGCTCCTCCATGAACTCCAACACCCCGCTGGTGAGGATAACAACACGCCTCTCTTCAACGGCAGACACCCCCATGCTGGCAGGGGTCTCCGAGTATGAACTTCCAGAGGACCCAAAATGGGAGTTTCCAAGAGATAA","411","translocation",,"RT-PCR, Sanger sequencing","N",,"28123544",,NULL,NULL
"32","SUPM2","SUP-M2","--","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4","NM_004304",,"I1116-V1392",,"NM_002520.6","NM_002520.6","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"Western blot, RT-PCR, NGS","N",,"28581487, 19147828, 23153582, 10994999, 27795556, 25533804, 25978431, 27780853, 26476082, 25873174, 26939704, 25820993, 25421750, 26133723, 26018086, 23239810, 26657151, 19887607, 25193384, 28557340, 31097696, 31804622",,NULL,NULL
"33","SUP-T13","SUP-T13","Sup-T13, SupT13, SUPT13, SUPT-13","Blood","FIP1L1","PDGFRA","FIP1L1","PDGFRA","PDGFRA","RECEPTOR TK","5156","P16234","NM_006206","NM_006206","NM_006206",,"L593-L954",,"NM_030917","NM_030917","FIP1L1-PDGFRA","4q12","4q12","9","12","551","GCCGAAGACTGTACTATGGAAGTTACACCAGGTGCAGAGATCCAAGATGGCAGATTCAATCTTTTTAAG","AAACCGAGGTATGAAATTCGCTGGAGGGTCATTGAATCAATCAGCCCAGATGGACATGAATATATTTATGTGGACCCGATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGAGATGGACTAGTGCTTG","773","Deletion",,"RT-PCR, NGS","N",,"23637631",,NULL,NULL
"34","TMD5","TMD5","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"Western blot, RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","23233201, 10071078",,NULL,NULL
"35","TOM-1","TOM-1","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","29655153, 2194587, 10766197, 10576511, 7693103, 9874796, 32581241",,NULL,NULL
"36","TPC-1","TPC-1","TPC1","Thyroid","CCDC6","RET","CCDC6","RET","RET","RECEPTOR TK","5979","P07949","NM_020630","NM_020630","NM_020975",,"L724-L1016",,"NM_005436.4","NM_005436.4","CCDC6-RET","10q21.2","10q11.21","1","12","712","AGTGCAATACTGCCCAAGCCCGGGCGGGGTCTCTGTTCTCTGGCAGAGGAGGTCCCTTGGCAGCGGGAAGCGCCCTCTCTTTCTCTCGCCGCCGCTCCGAGTCTGCGCCCTGGTGCCAGGCGCTCAGCTCGGCGCTCCCCTGTGCTCGCCCGGCGCCCACTCATTCGCAGCCCGGCCTTCGTCGCCGCCGCCTCCCTGCTGCTCCTCCTCCTTTCCCCAGCCCGCCGCGGCCATGGCGGACAGCGCCAGCGAGAGCGACACGGACGGGGCGGGGGGCAACAGCAGCAGCTCGGCCGCCATGCAGTCGTCCTGCTCGTCGACCTCGGGCGGCGGCGGTGGCGGCGGGGGAGGCGGCGGCGGTGGGAAGTCGGGGGGCATTGTCATCTCGCCGTTCCGCCTGGAGGAGCTCACCAACCGCCTGGCCTCGCTGCAGCAAGAGAACAAGGTGCTGAAGATAGAGCTGGAGACCTACAAACTGAAGTGCAAGGCACTGCAGGAGGAGAACCGCGACCTGCGCAAAGCCAGCGTGACCATC","GAGGATCCAAAGTGGGAATTCCCTCGGAAGAACTTGGTTCTTGGAAAAACTCTAGGAGAAGGCGAATTTGGAAAAGTGGTCAAGGCAACGGCCTTCCATCTGAAAGGCAGAGCAGGGTACACCACGGTGGCCGTGAAGATGCTGAAAG","461","inversion",,"PCR, Sanger sequencing, NGS","Y","TCGA-BJ-A0ZJ-01A, TCGA-BJ-A28Z-01A, TCGA-CE-A13K-01A, TCGA-DJ-A3V3-01A, TCGA-DJ-A4UQ-01A, TCGA-DJ-A4V5-01A, TCGA-DO-A1JZ-01A, TCGA-E3-A3E0-01A, TCGA-EL-A3TB-01A, TCGA-EL-A3ZP-01A, TCGA-ET-A3DR-01A, TCGA-FK-A3SE-01A","28500237, 20587502, 23637631, 27555670, 26265449, 23533265, 23856031, 28615362",,NULL,NULL
"37","TS9;22","TS9;22","TS9:22, TS9-22, TS 9:22","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511",,NULL,NULL
"38","U118MG","U-118 MG","U-118 MG, 1181N1, 1321N1, U-138 MG","Brain","FIG","ROS","GOPC","ROS1","ROS1","RECEPTOR TK","6098","P08922","NM_002944.2","NM_002944.2","NM_002944",,"L1945-F2222",,"NM_001017408","NM_001017408","GOPC-ROS1","6q22.1","6q22.1","7","35","1880","AGAGGAGAGATTGAATTTGAAGTAGTTTATGTGGCTCCTGAAGTGGATTCTGATGATGAAAACGTAGAGTATGAAGATGAGAGTGGACATCGTTACCGTTTGTACCTTGATGAGTTAGAAGGAGGTGGTAACCCTGGTGCTAGTTGCAAAGACACAAGTGGGGAAATCAAAGTATTACAAG","TCTGGCATAGAAGATTAAAGAATCAAAAAAGTGCCAAGGAAGGGGTGACAGTGCTTATAAACGAAGACAAAGAGTTGGCTGAGCTGCGAGGTCTGGCAGCCGGAGTAGGCCTGGCTAATGCCTGCTATGCAATACA","878","deletion",,"RT-PCR, Sanger sequencing, NGS","N",,"28960893, 12661006, 23637631, 27370605, 25231053, 23533265, 30171048",,NULL,NULL
"39","YAMN91","YAMN-91","YAMN91","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","26403224, 12506034",,NULL,NULL
"40","YOS-M","YOS-M","YOS-B","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511",,NULL,NULL
"41","YS9;22","YS9;22","YS9:22, YS9-22, YS 9:22","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511, 27908728",,NULL,NULL
"42","Z-119","Z-119","Z119","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511",,NULL,NULL
"43","Z-181","Z-181","Z181","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511",,NULL,NULL
"44","Z-33","Z-33","Z33","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6","NM_005157",,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","1","2","26","GGGGGGAGGGTGGCGGCTCGATGGGGGAGCCGCCTCCAGGGGGCCCCCCCGCCCTGTGCCCACGGCGCGGCCCCTTTAAGAGGCCCGCCTGGCTCCGTCATCCGCGCCGCGGCCACCTCCCCCCGGCCCTCCCCTTCCTGCGGCGCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","10576511",,NULL,NULL
"45","A925L","A925L","--","Lung","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4",,,"I1116-V1392",,,"NM_019063","EML4-ALK","2p21","2p23.2-p23.1","2","20","1057","ATGATAGTATTTCTGCTGCAAGTACTTCTGATGTTCAAGATCGCCTGTCAGCTCTTGAGTCACGAGTTCAGCAACAAGAAGATGAAATCACTGTGCTAAAGGCGGCTTTGGCTGATGTTTTGAGGCGTCTTGCAATCTCTGAAGATCATGTGGCCTCAGTGAAAAAATCAGTCTCAAGTAAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","632","inversion",,"RT-PCR, Sanger sequencing, FISH","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","25581823",,NULL,NULL
"46","ABC-11","ABC-11","--","Lung","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4",,,"I1116-V1392",,,"NM_019063","EML4-ALK","2p21","2p23.2-p23.1","6","20","1057","GCATAAAGATGTCATCATCAACCAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","785","inversion",,"RT-PCR, FISH","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","26719536, 25170107",,NULL,NULL
"47","ALL-1","ALL-1","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,,"NM_004327","BCR-ABL1","22q11.23","9q34.12","1","2","26","GCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"RT-PCR, Sanger sequencing","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","28515100, 2825022, 18073350",,NULL,NULL
"48","ALL-VG","ALL-VG","--","Blood","ETV6","ABL1","ETV6","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,,"NM_001987","ETV6-ABL1","12p13.2","9q34.12","4","2","26","GTGATGTGCTCTATGAACTCCTTCAGCATATTCTGAAGCAGAGGAAACCTCGGATTCTTTTTTCACCATTCTTCCACCCTGGAAACTCTATACACACACAGCCGGAGGTCATACTGCATCAGAACCATGAAGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1258","translocation",,"RT-PCR, Sanger sequencing, FISH","N",,"28650474, 18656692",,NULL,NULL
"49","ALL-VG","ALL-VG","--","Blood","ETV6","ABL1","ETV6","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,,"NM_001987","ETV6-ABL1","12p13.2","9q34.12","5","2","26","ATAACTGTGTCCAGAGGACCCCCAGGCCATCCGTGGATAATGTGCACCATAACCCTCCCACCATTGAACTGTTGCACCGCTCCAGGTCACCTATCACGACAAATCACCGGCCTTCTCCTGACCCCGAGCAGCGGCCCCTCCGGTCCCCCCTGGACAACATGATCCGCCGCCTCTCCCCGGCTGAGAGAGCTCAGGGACCCAGGCCGCACCAGGAGAACAACCACCAGGAGTCCTACCCTCTGTCAGTGTCTCCCATGGAGAATAATCACTGCCCAGCGTCCTCCGAGTCCCACCCGAAGCCATCCAGCCCCCGGCAGGAGAGCACACGCGTGATCCAGCTGATGCCCAGCCCCATCATGCACCCTCTGATCCTGAACCCCCGGCACTCCGTGGATTTCAAACAGTCCAGGCTCTCCGAGGACGGGCTGCATAGGGAAGGGAAGCCCATCAACCTCTCTCATCGGGAAGACCTGGCTTACATGAACCACATCATGGTCTCTGTCTCCCCGCCTGAAGAGCACGCCATGCCCATTGGGAGAATAGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1440","translocation",,"RT-PCR, Sanger sequencing, FISH","N",,"28650474, 18656692",,NULL,NULL
"50","C10","C10","--","Colon","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4",,,"I1116-V1392",,"NM_019063.4","NM_019063.4","EML4-ALK","2p21","2p23.2-p23.1","13","20","1057","AAATATGAAAAGCCAAAATTTGTGCAGTGTTTAGCATTCTTGGGGAATGGAGATGTTCTTACTGGAGACTCAGGTGGAGTCATGCTTATATGGAGCAAAACTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","1059","inversion",,"RT-PCR, Western blot, FISH","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","25926053",,NULL,NULL
"51","COST","COST","--","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304","NM_004304",,,"I1116-V1392",,"NM_002520.6","NM_002520.6","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"RT-PCR, PCR, FISH, Western blot","N",,"26657151, 15356659, 29581862",,NULL,NULL
"52","CUTO-2","CUTO-2","--","Lung","SDC4","ROS1","SDC4","ROS1","ROS1","RECEPTOR TK","6098","P08922","NM_002944.2","NM_002944.2",,,"L1945-F2222",,,"NM_002999","SDC4-ROS1","20q13.12","6q22.1","2","32","1749","ATCCGAGAGACTGAGGTCATCGACCCCCAGGACCTCCTAGAAGGCCGATACTTCTCCGGAGCCCTACCAGACGATGAGGATGTAGTGGGGCCCGGGCAGGAATCTGATGACTTTGAGCTGTCTGGCTCTGGAGATCTGG","CTGGAGTCCCAAATAAACCAGGCATTCCCAAATTACTAGAAGGGAGTAAAAATTCAATACAGTGGGAGAAAGCTGAAGATAATGGATGTAGAATTACATACTATATCCTTGAGATAAG","664","translocation",,"RT-PCR, FISH, Western blot","N",,"28428274, 27068398, 22919003, 24349229, 30053332, 30538120",,NULL,NULL
"53","CUTO-2","CUTO-2","--","Lung","SDC4","ROS1","SDC4","ROS1","ROS1","RECEPTOR TK","6098","P08922","NM_002944.2","NM_002944.2",,,"L1945-F2222",,,"NM_002999","SDC4-ROS1","20q13.12","6q22.1","2","34","1852","ATCCGAGAGACTGAGGTCATCGACCCCCAGGACCTCCTAGAAGGCCGATACTTCTCCGGAGCCCTACCAGACGATGAGGATGTAGTGGGGCCCGGGCAGGAATCTGATGACTTTGAGCTGTCTGGCTCTGGAGATCTGG","ATGATTTTTGGATACCAGAAACAAGTTTCATACTTACTATTATAGTTGGAATATTTCTGGTTGTTACAATCCCACTGACCTTTG","561","translocation",,"RT-PCR, FISH, Western blot","N",,"28428274, 27068398, 22919003, 24349229",,NULL,NULL
"54","CUTO-3","CUTO-3","--","Lung","MPRIP","NTRK1","MPRIP","NTRK1","NTRK1","RECEPTOR TK","4914","P04629","NM_002529.3","NM_002529.3",,,"I510-L781",,"NM_015134.3","NM_015134.3","MPRIP-NTRK1","17p11.2","1q23.1","21","12","451","GACAAGAAGTACGCAAGTGACAAGTACAAAGACATCTACACAGAGCTCAGCATCGCGAAGGCTAAGGCTGACTGTGACATCAGCAGGTTGAAGGAGCAGCTCAAGGCTGCAACGGAAGCACTGGGGGAGAAGTCCCCTGACAGTGCCACGGTGTCCGGATATG","GCCCGGCTGTGCTGGCTCCAGAGGATGGGCTGGCCATGTCCCTGCATTTCATGACATTGGGTGGCAGCTCCCTGTCCCCCACCGAGGGCAAAGGCTCTGGGCTCCAAGGCCACATCATCGAGAACCCACAATACTTCAGTGATGCCT","1331","translocation",,"RT-PCR, Sanger sequencing, FISH, Western blot, NGS","N",,"28428274, 24162815, 27370605, 30242093",,NULL,NULL
"55","DEL","DEL","--","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304","NM_004304",,,"I1116-V1392",,"NM_002520.6","NM_002520.6","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"RT-PCR, Western blot","N",,"25359993, 10994999, 8187071, 27795556, 27780853, 28557340, 31804622",,NULL,NULL
"56","DFCI-032","DFCI032","DFCI-032","Lung","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4",,,"I1116-V1392",,,"NM_019063","EML4-ALK","2p21","2p23.2-p23.1","13","20","1057","AAATATGAAAAGCCAAAATTTGTGCAGTGTTTAGCATTCTTGGGGAATGGAGATGTTCTTACTGGAGACTCAGGTGGAGTCATGCTTATATGGAGCAAAACTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","1059","inversion",,"RT-PCR, FISH, Western blot","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","28428274, 18594010, 26755435, 27119231, 23325296, 30791979",,NULL,NULL
"57","EM-2","EM-2","EM-2, EM-3","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,,"NM_004327","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR, Western blot, FISH, NGS","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","24836440, 28017647, 3332852, 10910924, 10576511, 23637631, 20809971",,NULL,NULL
"58","HEC59","HEC-59","--","Uterus","CAPZA2","MET","CAPZA2","MET","MET","RECEPTOR TK","4233","P08581","NM_001127500.3","NM_001127500.3",,,"V1078-I1345",,"NM_006136.3","NM_006136.3","CAPZA2-MET","7q31.2","7q31","1","6","567","GCCGCGGTTTGTCGCCAGAAGGAAGATGGCGGATCTGGAGGAGCAGTTGTCTGATGAAGAGAAG","GTTTTCCCAAATAGTGCACCCCTTGAAGGAGGGACAAGGCTGACCATATGTGGCTGGGACTTTGGATTTCGGAGGAATAATAAATTTGATTTAAAGAAAACTAGAGTTCTCCTTGGAAATGAGAGCTGCACCTTGACTTTAAGTGAGAGCACGATGAATAC","854","scramble",,"RT-PCR, Sanger sequencing, Western blot, NGS","Y","TCGA-78-7220-01A, TCGA-AR-A1AN-01A, TCGA-G7-6793-01A","26689674",,NULL,NULL
"59","JB-6","JB6","JB-6, JB","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304","NM_004304",,,"I1116-V1392",,"NM_002520.6","NM_002520.6","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"RT-PCR, Western blot","N",,"25359993, 8187071, 27795556, 11751994, 25193384",,NULL,NULL
"60","JK-1","JK-1","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR, FISH, NGS","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","28017647, 10576511, 20809971",,NULL,NULL
"61","KBM-5","KBM-5","KBM5","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","26912052, 8339266, 10576511, 19240172, 24334603, 28990077, 31837444",,NULL,NULL
"62","KT-1","KT-1","KT1","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","27908728, 9427720, 26421285",,NULL,NULL
"63","KYO-1","KYO-1","KYO-1, KPB-M15","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","28017647, 10576511, 3860700, 3332852, 29655153, 15610007, 24070327",,NULL,NULL
"64","L-82","L-82","--","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304","NM_004304",,,"I1116-V1392",,"NM_002520.6","NM_002520.6","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"RT-PCR, Sanger sequencing, FISH","N",,"27780853, 11908723, 7815887, 31804622",,NULL,NULL
"65","LN18","LN-18","--","Brain","PTPRZ1","MET","PTPRZ1","MET","MET","RECEPTOR TK","4233","P08581",,"NM_000245",,,"V1078-I1345",,,"NM_002851","PTPRZ1-MET","7q31.32","7q31","2","2","5'-UTR","ATTGGGCTAATGGATACTACAGACAACAGAGAAAACTTGTTGAAGAGATTGGCTGGTCCTATACAG","ATAAACCTCTCATAATGAAGGCCCCCGCTGTGCTTGCACCTGGCATCCTCGTGCTCCTGTTTACCTTGGTGCAGAGGAGCAATGGGGAGTGTAAAGAGGCACTAGCAAAGTCCGAGATGAATGTGAATATGAAGTATCAGCTTCCCAACTTCACCGCGGAAACACCCATCCAGAATGTCATTCTACATGAGCATCACATTTTCCTTGGTGCCACTAACTACATTTATGTTT","1436","scramble",,"RT-PCR, Sanger sequencing","Y","TCGA-06-5417-01A, TCGA-DU-6407-02B","28504721, 25135958",,NULL,NULL
"66","MEG-A2","MEG-A2","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","28017647, 10576511",,NULL,NULL
"67","MO-91","M0-91","MO-91, MO91, M091","Blood","ETV6","NTRK3","ETV6","NTRK3","NTRK3","RECEPTOR TK","4916","Q16288","NM_001012338.2","NM_001012338.2",,,"I538-G839",,"NM_001987","NM_001987","ETV6-NTRK3","12p13.2","15q25.3","4","15","528","GTGATGTGCTCTATGAACTCCTTCAGCATATTCTGAAGCAGAGGAAACCTCGGATTCTTTTTTCACCATTCTTCCACCCTGGAAACTCTATACACACACAGCCGGAGGTCATACTGCATCAGAACCATGAAGAAG","ATGTGCAGCACATTAAGAGGAGAGACATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGCTACAACCTCAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAG","465","translocation",,"RT-PCR, Western blot, NGS","Y","TCGA-AO-A03U-01B, TCGA-CE-A27D-01A, TCGA-CK-5913-01A, TCGA-CK-5916-01A, TCGA-DJ-A3UV-01A, TCGA-DJ-A4V0-01A, TCGA-E8-A438-01A, TCGA-EB-A51B-01A, TCGA-EL-A3ZN-01A, TCGA-FE-A3PD-01A","26216294, 17252008, 29237803, 30242093",,NULL,NULL
"68","MOLM-1","MOLM-1","MOLM1","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR, NGS","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","28017647, 10576511",,NULL,NULL
"69","MOLM-7","MOLM-7","MOLM-6, MOLM-8, MOLM-9, MOLM-10, MOLM-11, MOLM-12 ","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","25198091, 28017647, 7873501, 31349760",,NULL,NULL
"70","MYL","MYL","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR, FISH, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","27908728, 17432977",,NULL,NULL
"71","NALM-1","NALM-1","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","13","2","26","GTTTCAGAAGCTTCTCCCTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2006","translocation",,"PCR, RT-PCR, Western blot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","28017647, 21299849, 29665256, 10766197, 16169003, 2223646, 10576511, 28802831, 31349760",,NULL,NULL
"72","SJ-G2","SJ-GBM2","SJ-G2, SJG2","Brain","CLIP2","MET","CLIP2","MET","MET","RECEPTOR TK","4233","P08581","NM_000245.3","NM_000245.3",,,"V1078-I1345",,"NM_003388.4","NM_003388.4","CLIP2-MET","7q11.23","7q31","11","15","1009","ATGATTGAGTCGAATGACATTTCAGAGGAGACGATCAGGACGAAGGAAACTGTGGAGG","ATCAGTTTCCTAATTCATCTCAGAACGGTTCATGCCGACAAGTGCAGTATCCTCTGACAGACATGTCCCCCATCCTAACTAGTGGGGACTCTGATATATCCAGTCCATTACTGCAAAATACTGTCCACATTGACCTCAGTGCTCTAAATCCAGAGCTGGTCCAGGCAGTGCAGCATGTAGTGATTGGGCCCAGTAGCCTGATTGTGCATTTCAATGAAGTCATAGGAAGAG","1207","deletion",,"RT-PCR, NGS","N",,"27748748",,NULL,NULL
"73","SNU-2535","SNU-2535","SNU2535","Lung","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4","NM_004304",,"I1116-V1392",,"NM_019063.4","NM_019063.4","EML4-ALK","2p21","2p23.2-p23.1","13","20","1057","AAATATGAAAAGCCAAAATTTGTGCAGTGTTTAGCATTCTTGGGGAATGGAGATGTTCTTACTGGAGACTCAGGTGGAGTCATGCTTATATGGAGCAAAACTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","1059","inversion",,"RT-PCR, Western blot, RT-qPCR","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","23344087, 30943926",,NULL,NULL
"74","STE-1","STE-1","--","Lung","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4",,,"I1116-V1392",,"NM_019063.5","NM_019063.5","EML4-ALK","2p21","2p23.2-p23.1","13","20","1057","AAATATGAAAAGCCAAAATTTGTGCAGTGTTTAGCATTCTTGGGGAATGGAGATGTTCTTACTGGAGACTCAGGTGGAGTCATGCTTATATGGAGCAAAACTACTGTAGAGCCCACACCTGGGAAAGGACCTAAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","1059","inversion",,"RT-PCR, sequencing, FISH, NGS","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","28428274, 25173427, 26755435, 27811184",,NULL,NULL
"75","TALL-104","TALL-104","--","Blood","NUP214","ABL1","NUP214","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,,"NM_005085","NUP214-ABL1","9q34.13","9q34.12","32","2","26","ATACCTCTAACCTATTTGGAAACAGTGGGGCCAAGACATTTGGTGGATTTGCCAGCTCGTCGTTTGGAGAGCAGAAACCCACTGGCACTTTCAGCTCTGGAGGAGGAAGTGTGGCATCCCAAGGCTTTGGGTTTTCCTCTCCAAACAAAACAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","3071","scramble",,"RT-PCR, Sanger sequencing, Western blot, FISH","Y","TCGA-L5-A4OQ-01A","25120641, 15361874, 20073070",,NULL,NULL
"76","TK-6","TK6","LTR228, SKW 6.4, TK6, WIL2-NS, WIL2-S, TK-6","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","28017647, 10576511",,NULL,NULL
"77","U118MG","U-118 MG","U-118 MG, 1181N1, 1321N1, U-138 MG","Brain","PTPRZ1","MET","PTPRZ1","MET","MET","RECEPTOR TK","4233","P08581",,"NM_000245",,,"V1078-I1345",,,"NM_002851","PTPRZ1-MET","7q31.32","7q31","2","2","5'-UTR","ATTGGGCTAATGGATACTACAGACAACAGAGAAAACTTGTTGAAGAGATTGGCTGGTCCTATACAG","ATAAACCTCTCATAATGAAGGCCCCCGCTGTGCTTGCACCTGGCATCCTCGTGCTCCTGTTTACCTTGGTGCAGAGGAGCAATGGGGAGTGTAAAGAGGCACTAGCAAAGTCCGAGATGAATGTGAATATGAAGTATCAGCTTCCCAACTTCACCGCGGAAACACCCATCCAGAATGTCATTCTACATGAGCATCACATTTTCCTTGGTGCCACTAACTACATTTATGTTT","1436","scramble",,"RT-PCR, Sanger sequencing","Y","TCGA-06-5417-01A, TCGA-DU-6407-02B","28504721, 25135958",,NULL,NULL
"78","JURL-MK1","JURL-MK2","JURL-MK1, JURL-MK2","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,"NM_004327.3","NM_004327.3","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"RT-PCR,Westernblot","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","25198091, 9305612, 10576511, 28017647, 24349524",,NULL,NULL
"79","MC3","MC3","MC-3, MC3","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157.6","NM_005157.6",,,"I242-F493",,,"NM_004327","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"FISH,RT-PCR,Westernblot,Multiplexamplifiableprobehybridization(MAPH)","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","20809971, 7787756, 12759926, 10576511, 7693103",,NULL,NULL
"80","OCUM-8","OCUM-8","OCUM8","Stomach","CD44","IGF1R","CD44","IGF1R","IGF1R","RECEPTOR TK","3480","P08069","NM_000875","NM_000875","NM_000875",,"I999-F1274",,"NM_000610","NM_000610","CD44-IGF1R","11p13","15q26.3","1","12","828","CTCATTGCCCAGCGGACCCCAGCCTCTGCCAGGTTCGGTCCGCCATCCTCGTCCCGTCCTCCGCCGGCCCCTGCCCCGCGCCCAGGGATCCTCCAGCTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCG","AAGGAGCAGATGACATTCCTGGGCCAGTGACCTGGGAGCCAAGGCCTGAAAACTCCATCTTTTTAAAGTGGCCGGAACCTGAGAATCCCAATGGATTGATTCTAATGTATGAAATAAAATACGGATCACAAGTTGAG","561","translocation",,"RT-PCR, PCR, sequencing, Western blot, NGS","N",,"31222839",,NULL,NULL
"81","HCC2429","HCC2429","--","Lung/NUT","BRD4","NUT","BRD4","NUTM1","BRD4","ATYPICAL","23476","O60885","NM_058243.2","NM_058243.2",,,"K368-V440_W",,"NM_001284293.1","NM_001284293.1","BRD4-NUTM1","19p13.12","15q14","11","2","719","CTGAGAAAGTTGATGTGATTGCCGGCTCCTCCAAGATGAAGGGCTTCTCGTCCTCAGAGTCGGAGAGCTCCAGTGAGTCCAGCTCCTCTGACAGCGAAGACTCCGAAACAG","CATCTGCATTGCCGGGACCGGATATGAGCATGAAACCTAGTGCCGCCCTGTCTCCATCCCCTGCACTTCCCTTTCTCCCACCAACTTCTGACCCACCAGACCACCCACCCAGGGAGCCACCTCCACAGCCCATCATGCCTTCAGTATTCTCTCCAGACAACCCTCTGATGCTCTCTGCTTTCCCCAGCTCACTGTTGGTGACAGGGGACGGGGGCCCTTGCCTCAGTGGGG","1846","translocation",,"RT-PCR, Sanger sequencing, Western blot","N",,"25512383, 15994877, 24736545","Lung/NUT carcinoma",NULL,NULL
"82","SBC3","SBC-3","--","Lung","BRD4","NUTM1","BRD4","NUTM1","BRD4","ATYPICAL","23476","O60885","NM_001379292.1","NM_001379292.1",,,"K368-V440_W75-V147",,"NM_001284292.2","NM_001284292.2","BRD4-NUTM1","19p13.12","15q14","11","3","719","CTGAGAAAGTTGATGTGATTGCCGGCTCCTCCAAGATGAAGGGCTTCTCGTCCTCAGAGTCGGAGAGCTCCAGTGAGTCCAGCTCCTCTGACAGCGAAGACTCCGAAACAG","CATCTGCATTGCCGGGACCGGATATGAGCATGAAACCTAGTGCCGCCCCGTCTCCATCCCCTGCACTTCCCTTTCTCCCACCAACTTCTGACCCACCAGACCACCCACCCAGGGAGCCACCTCCACAGCCCATCATGCCTTCAGTATTCTCTCCAGACAACCCTCTGATGCTCTCTGCTTTCCCCAGCTCACTGTTGGTGACAGGGGATGGGGGCCCTTGCCTCAGTGGGGCTGGGGCTGGCAAGGTCATTGTCAAAGTCAAGACAGAAGGGGGGTCAGCTGAGCCCTCTCAAACTCAGAACTTTATCCTTACTCAGACTGCCCTCAATTCGACTGCCCCGGGCACTCCCTGTGGAGGCCTTGAGGGTCCTGCACCTCCATTTGTGACAGCATCTAATGTGAAGACCATTCTGCCCTCTAAGGCTGTTGGTGTCAGCCAGGAGGGTCCTCCAGGCCTTCCGCCTCAGCCTCCACCACCAGTTGCTCAACTGGTCCCCATTGTGCCCCTGGAAAAAGCTTGGCCAGGGCCACATGGGACAACCGGGGAAGGAGGTCCTGTGGCCACTCTATCCAAGCCTTCCCTAGGTGACCGCTCCAAAATTTCCAAGGACGTTTATGAGAACTTCCGTCAGTGGCAGCGTTACAAAGCCTTGGCCCGGAGGCACCTATCCCAGAGTCCTGACACAGAAGCTCTTTCCTGTTTTCTTAT","1846","translocation",,"RT-PCR, Sanger, FISH, NGS","N",,"31097696",,"Reference: hg38",NULL
"83","Ty-82","Ty-82","--","Thymus/NUT","BRD4","NUT","BRD4","NUTM1","BRD4","ATYPICAL","23476","O60885","NM_058243.2","NM_058243.2",,,"K368-V440_W",,"NM_001284293.1","NM_001284293.1","BRD4-NUTM1","19p13.12","15q14","14","2","1056","CTTTGCACAACGCACTACCCCAGCAGCCATCACGGCCCAGCAACCGAGCCGCTGCCCTGCCTCCCAAGCCCGCCCGGCCCCCAGCCGTGTCACCAGCCTTGACCCAAACACCCCTGCTCCCACAGCCCCCCATGGCCCAACCCCCCCAAGTGCTGCTGGAGGATGAAGAGCCACCTGCCCCACCCCTCACCTCCATGCAGATGCAGCTGTACCTGCAGCAGCTGCAGAAGGTGCAGCCCCCTACGCCGCTACTCCCTTCCGTGAAGGTGCAGTCCCAGCCCCCACCCCCCCTGCCGCCCCCACCCCACCCCTCTGTGCAGCAGCAGCTGCAGCAGCAGCCGCCACCACCCCCACCACCCCAGCCCCAGCCTCCACCCCAGCAGCAGCATCAGCCCCCTCCACGGCCCGTGCACTTGCAGCCCATGCAGTTTTCCACCCACATCCAACAGCCCCCGCCACCCCAGGGCCAGCAGCCCCCCCATCCGCCCCCAGGCCAGCAGCCACCCCCGCCGCAGCCTGCCAAGCCTCAGCAAGTCATCCAGCACCACCATTCACCCCGGCACCACAAGTCGGACCCCTACTCAACCG","CATCTGCATTGCCGGGACCGGATATGAGCATGAAACCTAGTGCCGCCCTGTCTCCATCCCCTGCACTTCCCTTTCTCCCACCAACTTCTGACCCACCAGACCACCCACCCAGGGAGCCACCTCCACAGCCCATCATGCCTTCAGTATTCTCTCCAGACAACCCTCTGATGCTCTCTGCTTTCCCCAGCTCACTGTTGGTGACAGGGGACGGGGGCCCTTGCCTCAGTGGGG","2183","translocation",,"RT-PCR, Sanger sequencing, Western blot","N",,"24736545","Thymus/NUT carcinoma",NULL,NULL
"84","PER-403","PER-403","--",,"BRD4","NUT","BRD4","NUTM1","BRD4","ATYPICAL","23476","O60885","NM_058243.2","NM_058243.2",,,"K368-V440_W75-V147",,"NM_001284293.1","NM_001284293.1","BRD4-NUTM1","19p13.12","15q14","11","2","719","CTGAGAAAGTTGATGTGATTGCCGGCTCCTCCAAGATGAAGGGCTTCTCGTCCTCAGAGTCGGAGAGCTCCAGTGAGTCCAGCTCCTCTGACAGCGAAGACTCCGAAACAG","CATCTGCATTGCCGGGACCGGATATGAGCATGAAACCTAGTGCCGCCCTGTCTCCATCCCCTGCACTTCCCTTTCTCCCACCAACTTCTGACCCACCAGACCACCCACCCAGGGAGCCACCTCCACAGCCCATCATGCCTTCAGTATTCTCTCCAGACAACCCTCTGATGCTCTCTGCTTTCCCCAGCTCACTGTTGGTGACAGGGGACGGGGGCCCTTGCCTCAGTGGGGCTGGGGCTGGCAAGGTCATTGTCAAAGTCAAGACAGAAGGGGGGTCAGCTGAGCCCTCTCAAACTCAGAACTTTATCCTTACTCAGACTGCCCTCAATTCGACTGCCCCGGGCACTCCCTGTGGAGGCCTTGAGGGTCCTGCACCTCCATTTGTGACAGCATCTAATGTGAAGACCATTCTGCCCTCTAAGGCTGTTGGTGTCAGCCAGGAGGGTCCTCCAGGCCTTCCGCCTCAGCCTCCACCACCAGTTGCTCAACTGGTCCCCATTGTGCCCCTGGAAAAAGCTTGGCCAGGGCCACATGGGACAACCGGGGAAGGAGGTCCTGTGGCCACTCTATCCAAGCCTTCCCTAGGTGACCGCTCCAAAATTTCCAAGGACGTTTATGAGAACTTCCGTCAGTGGCAGCGTTACAAAGCCTTGGCCCGGAGGCACCTATCCCAGAGTCCTGACACAGAAGCTCTTTCCTGTTTTCTTAT","1846","translocation",,"RT-PCR, Western blot, Genomic PCR, Sanger sequencing, FISH, NGS","N",,"23128391","For PER-403 cell line the tissue of origin is not reported, because this cell line was generated from a NUT carcinoma (formerly known as NUT-Midline Carcinoma (NMC)), a rare and aggressive form of cancer spread in the body, often along the midline structure (Thompson-Wicking K. et al., 2013)","Reference: hg38",NULL
"85","PER-624","PER-624","--",,"BRD4","NUT","BRD4","NUTM1","BRD4","ATYPICAL","23476","O60885","NM_058243.2","NM_058243.2",,,"K368-V440_W75-V147",,"NM_001284292.2","NM_001284292.2","BRD4-NUTM1","19p13.12","15q14","15","2","1093","GTCACCTCCGCGAAGCCCCCTCCCCGCTTATGATACATTCCCCCCAGATGTCACAGTTCCAGAGCCTGACCCACCAGTCTCCACCCCAGCAAAACGTCCAGCCTAAGAAACAG","GTTACTCTGGGTCCTGGACCTGACTGCCTCATTCTGGAGGCTTCCAGACAGCCACAGTTAGTGCCCAAACCTGAGAGGATGGCTTCAGATGGAG","2252","translocation",,"RT-PCR, Western blot, Genomic PCR, Sanger sequencing, NGS","N",,"23128391","For PER-624 cell line the tissue of origin is not reported, because this cell line was generated from a NUT carcinoma (formerly known as NUT-Midline Carcinoma (NMC)), a rare and aggressive form of cancer spread in the body, often along the midline structure (Thompson-Wicking K. et al., 2013)","Reference: hg38",NULL
"86","MyLa","MyLa","MyLa 1850, MyLa 1885, MyLa 1928, MyLa 1929, MyLa 2000, MyLa 2039, MyLa 2059, MyLa 2355, MyLa 3241, MyLa 3675","Skin","NPM1","TYK2","NPM1","TYK2","TYK2","NON RECEPTOR TK","7297","P29597","NM_003331","NM_003331",,,"L897-Y1176_I589-A875",,"NM_002520","NM_002520","NPM1-TYK2","5q35.1","19p13.2","9","16","725","GGACAAGAATCCTTCAAGAAACAGGAAAAAACTCCTAAAACACCAAAAGGACCTAGTTCTGTAGAAGACATTAAAGCAAAAATGCAAGCAAGTATAGAAAAA","GAGAACAAGAACCTGGTTCATGGTAATGTGTGTGGCCGGAACATCCTGCTGGCCCGGCTGGGGTTGGCAGAGGGCACCAGCCCCTTCATCAAGCTGAGTGATCCTGGCGTGGGCCTGGGCGCCCTCTCCAGGGAGG","719","translocation",,"RT-PCR, Sanger sequencing, PCR, Western blot, fish, NGS","N",,"25349176, 30131584",,NULL,"The fusion gene is predicted to yield a product comprising a small portion of the TYK2 pseudokinase domain and the entire C-terminal kinase domain."
"87","CUTO-23","CUTO-23","--","Lung","CD74","ROS1","CD74","ROS1","ROS1","RECEPTOR TK","6098","P08922","NM_002944.2","NM_002944.2",,,"L1945-F2222",,,"NM_004355","CD74-ROS1","5q33.1","6q22.1","6","34","1852","GTCTTTGAGAGCTGGATGCACCATTGGCTCCTGTTTGAAATGAGCAGGCACTCCTTGGAGCAAAAGCCCACTGACGCTCCACCGAAAG","ATGATTTTTGGATACCAGAAACAAGTTTCATACTTACTATTATAGTTGGAATATTTCTGGTTGTTACAATCCCACTGACCTTTG","703","translocation",,"RT-PCR, Sequencing, NGS, FISH, Western blot","Y","TCGA-64-1680-01A, TCGA-86-8278-01A","29636358, 30538120",,NULL,NULL
"88","CUTO-33","CUTO-33","--","Lung","CD74","ROS1","CD74","ROS1","ROS1","RECEPTOR TK","6098","P08922","NM_002944.2","NM_002944.2",,,"L1945-F2222",,,"NM_004355","CD74-ROS1","5q33.1","6q22.1","6","34","1852","GTCTTTGAGAGCTGGATGCACCATTGGCTCCTGTTTGAAATGAGCAGGCACTCCTTGGAGCAAAAGCCCACTGACGCTCCACCGAAAG","ATGATTTTTGGATACCAGAAACAAGTTTCATACTTACTATTATAGTTGGAATATTTCTGGTTGTTACAATCCCACTGACCTTTG","703","translocation",,"RT-PCR, FISH, Western blot","Y","TCGA-64-1680-01A, TCGA-86-8278-01A","30538120",,NULL,NULL
"89","AP-1060","AP-1060","--","Blood","ETV6","NTRK3","ETV6","NTRK3","NTRK3","RECEPTOR TK","4916","Q16288","NM_001012338.2","NM_001012338.2",,,"I538-G839",,"NM_001987","NM_001987","ETV6-NTRK3","12p13.2","15q25.3","4","14","465","GTGATGTGCTCTATGAACTCCTTCAGCATATTCTGAAGCAGAGGAAACCTCGGATTCTTTTTTCACCATTCTTCCACCCTGGAAACTCTATACACACACAGCCGGAGGTCATACTGCATCAGAACCATGAAGAAG","GTCCCGTGGCTGTCATCAGTGGTGAGGAGGACTCAGCCAGCCCACTGCACCACATCAACCACGGCATCACCACGCCCTCGTCACTGGATGCCGGGCCCGACACTGTGGTCATTGGCATGACTCGCATCCCTGTCATTGAGAACCCCCAGTACTTCCGTCAGGGACACAACTGCCACAAGCCGGACACGT","528","translocation",,"Spectral Karyotiping, FISH, RT-PCR, genomic/transcriptomic microarray-based profiling, NGS","Y","TCGA-AO-A03U-01B, TCGA-CE-A27D-01A, TCGA-CK-5913-01A, TCGA-CK-5916-01A, TCGA-DJ-A3UV-01A, TCGA-DJ-A4V0-01A, TCGA-E8-A438-01A, TCGA-EB-A51B-01A, TCGA-EL-A3ZN-01A, TCGA-FE-A3PD-01A","29119387",,NULL,NULL
"90","SNU-2292","SNU-2292","SNU2292","Lung","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304.4","NM_004304.4",,,"I1116-V1392",,"NM_019063.5","NM_019063.5","EML4-ALK","2p21","2p23.2-p23.1","6","20","1057","GCATAAAGATGTCATCATCAACCAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","785","inversion",,"RT-PCR,Westernblot,RT-qPCR","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","30943926",,NULL,NULL
"91","HCC78","HCC78","--","Lung","SLC34A2","ROS1","SLC34A2","ROS1","ROS1","RECEPTOR TK","6098","P08922","NM_002944","NM_002944",,,"L1945-F2222",,"NM_006424","NM_006424","SLC34A2-ROS1","4p15.2","6q22.1","4","32","1749","AGAGAGACACCAAAGGGAAGATTCTCTGTTTCTTCCAAGGGATTGGGAGATTGATTTTACTTCTCGGATTTCTCTACTTTTTCGTGTGCTCCCTGGATATTCTTAGTAGCGCCTTCCAGCTGGTTGGAG","CTGGAGTCCCAAATAAACCAGGCATTCCCAAATTACTAGAAGGGAGTAAAAATTCAATACAGTGGGAGAAAGCTGAAGATAATGGATGTAGAATTACATACTATATCCTTGAGATAAG","724","translocation",,"NGS, RT-PCR, Western, FISH, RT-qPCR","N",,"25485619, 22919003, 29738763, 31097696, 24349229, 24218589, 26459174, 27370605, 27068398, 26791794, 28073897, 27738334, 25384172, 24469055, 23788756, 23533265, 22915320, 24386191, 28802831, 28181564, 30053332, 30115026, 30262706, 30538120, 30943926, 31572036, 32923114, 31118036",,NULL,NULL
"92","HNT-34","HNT-34","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157","NM_005157",,,"I242-F493",,"NM_004327","NM_004327","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"NGS, RT-PCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","25485619, 10576511, 9266939, 29142066, 25006129",,NULL,NULL
"93","K-562","K-562","DD, K-562, K-562/ADM, K-562/Adr, K-562/MTX-2, K-562/Vin, KO51, P2UR/K-562, PC-MDS, RM-10, RS-1, SAM-1, SPI-801, SPI-802, T-33, TI-1","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157","NM_005157",,,"I242-F493",,"NM_004327","NM_004327","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"NGS, Western blot, RT-PCR, real time PCR, Sanger sequencing, DNA-Based Looped Ligation Assay (LOLA), FISH, Multiplex amplifiable probe hybridization (MAPH), Anchored ChromPET NGS, ddPCR","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","2194587, 7693103, 10576511, 12759926, 15610007, 17497325, 18784740, 20809971, 20860819, 22782217, 23124138, 23201011, 23233201, 23613107, 23788109, 23872305, 24012109, 24070327, 24091918, 24112092, 24373969, 24657894, 24747551, 25029499, 25216532, 25485619, 25485910, 25536607, 25697481, 25699654, 25919613, 26002693, 26179066, 26291129, 26456889, 26554155, 26582603, 26631023, 26667895, 26912052, 26912659, 27307395, 27329306, 27353341, 27472284, 27730241, 27890928, 27908728, 27928132, 27965460, 28017647, 28086219, 28128329, 28323047, 28338290, 28345463, 28377570, 28401599, 28515100, 28533480, 28639894, 28752075, 28789344, 28802831, 28990077, 29046997, 29272786, 29608815, 29655153, 29691899, 29808796, 29913272, 30049824, 30593760, 30784762, 31071955, 31138265, 31280200, 31518872, 32153174, 31349760, 31311809, 32203161",,NULL,NULL
"94","KG-1","KG-1","KG-1, KG-1a, KG-1-B, KMT-2","Blood","FGFR1OP2","FGFR1","FGFR1OP2","FGFR1","FGFR1","RECEPTOR TK","2260","P11362","NM_023110","NM_023110",,,"L478-L767",,"NM_015633","NM_015633","FGFR1OP2-FGFR","12p11.23","8p11.23","4","10","428","AATTACGTACATCTCTGGAAGAACATCAGTCGGCCTTGGAACTTATAATGAGCAAGTACCGAGAACAAATGTTTAGATTGCTAATGGCTAGCAAAAAAGATGATCCGGGTATAATAATGAAGTTAAAAGAGCAGCACTCCAAG","GTGTCTGCTGACTCCAGTGCATCCATGAACTCTGGGGTTCTTCTGGTTCGGCCATCACGGCTCTCCTCCAGTGGGACTCCCATGCTAGCAGGGGTCTCTGAGTATGAGCTTCCCGAAGACCCTCGCTGGGAGCTGCCTCGGGACAG","526","translocation",,"NGS, PCR, Sanger sequencing, Western blot","N",,"25485619, 20587502, 16946300, 28881484, 27627808, 22875628, 22875613, 28802831, 32315352",,NULL,NULL
"95","KU812","KU812","KU812, KU812F, KU812E","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157","NM_005157",,,"I242-F493",,"NM_004327","NM_004327","BCR-ABL1","22q11.23","9q34.12","14","2","26","ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAA","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","2031","translocation",,"NGS, RT-PCR, FISH, Western blot,Anchored ChromPET NGS","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","25485619, 10576511, 28017647, 26002693, 20809971, 26202951, 28128329, 23233089, 28267803, 20860819, 18089786, 26874514, 24691473, 28556300, 26456889, 26631023, 32203161",,NULL,NULL
"96","MOLM-16","MOLM-16","--","Blood","ELAVL1","TYK2","ELAVL1","TYK2","TYK2","NON RECEPTOR TK","7297","P29597","NM_003331","NM_003331",,,"L897-Y1176_I589-A875",,"NM_001419","NM_001419","ELAVL1-TYK2","19p13.2","19p13.2","2","19","872","ATTTTTGAAAAATACAATGTCTAATGGTTATGAAGACCACATGGCCGAAGACTGCAGGGGTGACATCGGGAGAACGAATTTGATCGTCAACTACCTCCCTCAGAACATGACCCAGGATGAGTTACGAAGCCTGTTCAGCAGCATTGGTGAAGTTGAATCTGCAAAACTTATTCGGGATAAAGTAGCAG","ATCTTGCTGACGTCTTGACTGTGAACCCGGACTCACCGGCGTCGGACCCTACGGTTTTCCACAAGCGCTATTTGAAAAAGATCCGAGATCTGGGCGAG","372","scramble",,"NGS, aCGH, RT-qPCR, Western blot","N",,"25485619, 27189703",,NULL,"The fusion gene is predicted to yield a product comprising a small portion of the TYK2 pseudokinase domain and the entire C-terminal kinase domain."
"97","NCI-H2228","NCI-H2228","--","Lung","EML4","ALK","EML4","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304","NM_004304",,,"I1116-V1392",,"NM_019063","NM_019063","EML4-ALK","2p21","2p23.2-p23.1","6","20","1057","GCATAAAGATGTCATCATCAACCAAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","785","inversion",,"NGS, RT-PCR, Sanger sequencing, FISH, Western blot, exon array, RT-qPCR, nanostring","Y","TCGA-2Z-A9JJ-01A, TCGA-50-8460-01A, TCGA-67-6215-01A, TCGA-67-6216-01A, TCGA-78-7163-01A, TCGA-86-A4P8-01A, TCGA-E8-A432-01A","25485619, 26755435, 21613408, 25173427, 25581823, 26719536, 18594010, 27206799, 28549458, 28356934, 28675026, 24972969, 24885608, 24792336, 24675041, 26459174, 26939704, 28032602, 28073897, 28740365, 26639656, 26419961, 28370702, 28741662, 27119231, 27811184, 25740311, 26599807, 25502629, 27078848, 24674157, 25349307, 24021598, 24419060, 25193384, 24469055, 24022839, 23533265, 23669222, 23817194, 23325296, 28802831, 281815, 32020234, 32596809, 33246076, 33271368",,NULL,NULL
"98","OCI-AML2","OCI-AML2","--","Blood","MBNL1","RAF1","MBNL1","RAF1","RAF1","TKL","5894","P04049","NM_002880","NM_002880",,,"V349-L609",,"NM_207293","NM_207293","MBNL1-RAF1","3q25.1-q","3p25.2","6","5","141","ACTCAGTCGGCTGTCAAATCACTGAAGCGACCCCTCGAGGCAACCTTTGACCTG","GCTCGGAAGACGTTCCTGAAGCTTGCCTTCTGTGACATCTGTCAGAAATTCCTGCTCAATGGATTTCGATGTCAGACTTGTGGCTACAAATTTCATGAGCACTGTAGCACCAAAGTACCTACTATGTGTGTGGACTGGAGTAACATCAGACAACTCTT","794","inversion",,"NGS, Western blot","N",,"25485619, 28162770, 31097696",,NULL,NULL
"99","SR","SR-786","SR, SR-786","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304","NM_004304",,,"I1116-V1392",,"NM_002520","NM_002520","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"NGS, RT-PCR, Western blot","N",,"25485619, 8187071, 27795556, 28557340, 26476082, 26939704, 25820993, 30381447, 31804622",,NULL,NULL
"100","SU-DHL-1","SU-DHL-1","--","Blood","NPM1","ALK","NPM1","ALK","ALK","RECEPTOR TK","238","Q9UM73","NM_004304","NM_004304",,,"I1116-V1392",,"NM_002520","NM_002520","NPM1-ALK","5q35.1","2p23.2-p23.1","4","20","1057","GTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAG","TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG","680","translocation",,"NGS, RT-PCR, Western blot","N",,"25485619, 10994999,  8187071, 27795556, 28675026, 23153582, 24218589, 25301075, 26657151, 26258416, 27780853, 25359993, 26476082, 25533804, 25873174, 26939704, 25820993, 26018086, 28806414, 24486291, 25193384, 24386191, 28557340, 29627725, 30381447, 32193476, 30262555",,NULL,NULL
"101","SUP-B15","SUP-B15","--","Blood","BCR","ABL1","BCR","ABL1","ABL1","NON RECEPTOR TK","25","P00519","NM_005157","NM_005157",,,"I242-F493",,"NM_004327","NM_004327","BCR-ABL1","22q11.23","9q34.12","1","2","26","GCAGAGTGCGGGCCGGGCGGGAGTGCGGCGAGAGCCGGCTGGCTGAGCTTAGCGTCCGAGGAGGCGGCGGCGGCGGCGGCGGCACGGCGGCGGCGGGGCTGTGGGGCGGTGCGGAAGCGAGAGGCGAGGAGCGCGCGGGCCGTGGCCAGAGTCTGGCGGCGGCCTGGCGGAGCGGAGAGCAGCGCCCGCGCCTCGCCGTGCGGAGGAGCCCCGCACACAATAGCGGCGCGCGCAGCCCGCGCCCTTCCCCCCGGCGCGCCCCGCCCCGCGCGCCGAGCGCCCCGCTCCGCCTCACCTGCCACCAGGGAGTGGGCGGGCATTGTTCGCCGCCGCCGCCGCCGCGCGGGCCATGGGGGCCGCCCGGCGCCCGGGGCCGGGCTGGCGAGGCGCCGCGCCGCCGCTGAGACGGGCCCCGCGCGCAGCCCGGCGGCGCAGGTAAGGCCGGCCGCGCCATGGTGGACCCGGTGGGCTTCGCGGAGGCGTGGAAGGCGCAGTTCCCGGACTCAGAGCCCCCGCGCATGGAGCTGCGCTCAGTGGGCGACATCGAGCAGGAGCTGGAGCGCTGCAAGGCCTCCATTCGGCGCCTGGAGCAGGAGGTGAACCAGGAGCGCTTCCGCATGATCTACCTGCAGACGTTGCTGGCCAAGGAAAAGAAGAGCTATGACCGGCAGCGATGGGGCTTCCGGCGCGCGGCGCAGGCCCCCGACGGCGCCTCCGAGCCCCGAGCGTCCGCGTCGCGCCCGCAGCCAGCGCCCGCCGACGGAGCCGACCCGCCGCCCGCCGAGGAGCCCGAGGCCCGGCCCGACGGCGAGGGTTCTCCGGGTAAGGCCAGGCCCGGGACCGCCCGCAGGCCCGGGGCAGCCGCGTCGGGGGAACGGGACGACCGGGGACCCCCCGCCAGCGTGGCGGCGCTCAGGTCCAACTTCGAGCGGATCCGCAAGGGCCATGGCCAGCCCGGGGCGGACGCCGAGAAGCCCTTCTACGTGAACGTCGAGTTTCACCACGAGCGCGGCCTGGTGAAGGTCAACGACAAAGAGGTGTCGGACCGCATCAGCTCCCTGGGCAGCCAGGCCATGCAGATGGAGCGCAAAAAGTCCCAGCACGGCGCGGGCTCGAGCGTGGGGGATGCATCCAGGCCCCCTTACCGGGGACGCTCCTCGGAGAGCAGCTGCGGCGTCGACGGCGACTACGAGGACGCCGAGTTGAACCCCCGCTTCCTGAAGGACAACCTGATCGACGCCAATGGCGGTAGCAGGCCCCCTTGGCCGCCCCTGGAGTACCAGCCCTACCAGAGCATCTACGTCGGGGGCATGATGGAAGGGGAGGGCAAGGGCCCGCTCCTGCGCAGCCAGAGCACCTCTGAGCAGGAGAAGCGCCTTACCTGGCCCCGCAGGTCCTACTCCCCCCGGAGTTTTGAGGATTGCGGAGGCGGCTATACCCCGGACTGCAGCTCCAATGAGAACCTCACCTCCAGCGAGGAGGACTTCTCCTCTGGCCAGTCCAGCCGCGTGTCCCCAAGCCCCACCACCTACCGCATGTTCCGGGACAAAAGCCGCTCTCCCTCGCAGAACTCGCAACAGTCCTTCGACAGCAGCAGTCCCCCCACGCCGCAGTGCCATAAGCGGCACCGGCACTGCCCGGTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAG","AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAG","1530","translocation",,"NGS, real time PCR, Sanger sequencing, PCR, RT-PCR, Western blot, Multiplex amplifiable probe hybridization (","Y","TCGA-AB-2817-03A, TCGA-AB-2901-03A, TCGA-AB-2941-03A, TCGA-AB-2944-03A","25485619, 26002693, 21299849, 29113191, 10576511, 28390196, 28128329, 24968304, 12759926, 24112092, 25919613, 25202073, 25692130, 25029499, 24961450, 24349524, 28802831, 30784762, 32581241, 31349760",,NULL,NULL
"102","RT4","RT4","--","Urinary ","FGFR3","TACC3","FGFR3","TACC3","FGFR3","RECEPTOR TK","2261","P22607","NG_012632.1",,,,"L472-L761",,"NM_006342.3","NM_006342.3","FGFR3-TACC3","4p16.3","4p16.3","intron 18","4 (-124 bp) ","intron 18","GTACATGATCATGCGGGAGTGCTGGCATGCCGCGCCCTCCCAGAGGCCCACCTTCAAGCAGCTGGTGGAGGACCTGGACCGTGTCCTTACCGTGACGTCCACCGACGTGAGTGCTGGCTCTGGCCTGGTGCCACCCGCCTATGCCCCTCCCCCTGCCGTCCCCGGCCATCCTGCCCCCCAGAGTGCTGAGGTGTGGGGCGGGCCT","TCTGGCCCAGGTGCCCTGGCTGACCTGGACTGCTCAAGCTCTTCCCAGAGCCCAGGAAGTTCTGAGAACCAAATGGTGTCTCCAGGAAAAGTGTCTGGCAGCCCTGAGCAAGCCGTGGAGGAAAACCTTAGTTCCTATTCCTTAGACAGAAGAGTGACACCCGCCTCTGAGACCCTAGAAGACCCTTGCAGGACAGAGTCCCAGCACAAAGCGGAGACTCCGCACGGAGCC","1489","scramble",,"RT-PCR, Sanger sequencing, Western blot, FISH, RNA-FISH, NGS","Y","TCGA-06-2567-01A, TCGA-14-0789-01A, TCGA-14-1823-01A, TCGA-14-1829-01A, TCGA-22-4607-01A, TCGA-27-1835-01A, TCGA-34-2608-01A, TCGA-38-4630-01A, TCGA-39-5024-01A, TCGA-63-7022-01A, TCGA-66-2786-01A, TCGA-76-4925-01A","31097696, 27930669, 23175443, 24784839, 27029060, 27627808, 28802831, 28855393, 32315352",,NULL,NULL
"103","RT112","RT-112","--","Urinary ","FGFR3","TACC3","FGFR3","TACC3","FGFR3","RECEPTOR TK","2261","P22607","NM_001163213","NM_001163213",,,"L472-L761",,"NM_006342","NM_006342","FGFR3-TACC3","4p16.3","4p16.3","17","11","759","GTACATGATCATGCGGGAGTGCTGGCATGCCGCGCCCTCCCAGAGGCCCACCTTCAAGCAGCTGGTGGAGGACCTGGACCGTGTCCTTACCGTGACGTCCACCGAC","GTAAAGGCGACACAGGAGGAGAACCGGGAGCTGAGGAGCAGGTGTGAGGAGCTCCACGGGAAGAACCTGGAACTGGG","951","scramble",,"NGS, RT-PCR, Sanger sequencing, Western blot, RNA-FISH","Y","TCGA-06-2567-01A, TCGA-14-0789-01A, TCGA-14-1823-01A, TCGA-14-1829-01A, TCGA-22-4607-01A, TCGA-27-1835-01A, TCGA-34-2608-01A, TCGA-38-4630-01A, TCGA-39-5024-01A, TCGA-63-7022-01A, TCGA-66-2786-01A, TCGA-76-4925-01A","25485619, 23175443, 31097696, 28855393, 24784839, 28108151, 27029060, 27930669, 27627808, 27885740, 29262532, 24909170, 28181564, 32315352",,NULL,NULL
"104","SW 780","SW 780","--","Urinary ","FGFR3","BAIAP2","FGFR3","BAIAP2","FGFR3","RECEPTOR TK","2261","P22607","NM_001163213","NM_001163213",,,"L472-L761",,"NM_018842","NM_018842","FGFR3-BAIAP2L","4p16.3","7q21.3-q22.1","17","2","759","GTACATGATCATGCGGGAGTGCTGGCATGCCGCGCCCTCCCAGAGGCCCACCTTCAAGCAGCTGGTGGAGGACCTGGACCGTGTCCTTACCGTGACGTCCACCGAC","AATGTTATGGAACAGTTCAATCCTGGGCTGCGAAATTTAATAAACCTGGGGAAAAATTATGAGAAAGCTGTAAACG","1254","translocation",,"NGS, RT-PCR, Sanger sequencing, Western blot, FISH","N",,"25485619, 23175443, 24784839, 27627808, 27885740, 29262532, 28802831",,NULL,NULL
"105","KM-12","KM-12","--","Colon","TPM3","NTRK1","TPM3","NTRK1","NTRK1","RECEPTOR TK","4914","P04629","NM_002529","NM_002529",,,"I510-L781",,"NM_152263","NM_152263","TPM3-NTRK1","1q21.3","1q23.1","8","10","398","GCAGAGACCCGTGCTGAGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAG","ACACTAACAGCACATCTGGAGACCCGGTGGAGAAGAAGGACGAAACACCTTTTGGG","656","inversion",,"NGS, RT-PCR,Western blot, RT-qPCR, Sanger sequencing","Y","TCGA-DX-A3UA-01A, TCGA-EL-A3D4-01A","25485619, 31097696, 24962792, 26216294, 26716414, 26939704, 26001971, 25054037, 28751539, 29360440, 29463555, 30115026, 30242093",,NULL,NULL
"106","PL-18","PL-18","--","Pancreas","ATG7","RAF1","ATG7","RAF1","RAF1","TKL","5894","P04049",,"NM_002880","NM_002880",,"V349-L609",,,"NM_006395.2","ATG7-RAF1","3p25.3","3p25.2","18","7","226","GTTCTTGATCAATATGAACGAGAAGGATTTAACTTCCTAGCCAAGGTGTTTAATTCTTCACATTCCTTCTTAGAAGACTTGACTGGTCTTACATTGCTGCATCAAGAAACCCAAGCTGCTGAG","TTCTCAGCACAGATATTCTACACCTCACGCCTTCACCTTTAACACCTCCAGTCCCTCATCTGAAGGTTCCCTCTCCCAGAGGCAGAGGTCGACATCCACACCTAATGTCCACATGGTCAGCACCACCCTGCCTGTGGACAGCAGGATGATTGAG","1114","inversion",,"RT-PCR, Sanger, FISH, NGS","N",,"31097696",,NULL,NULL
"107","AN3 CA","AN3 CA","--","Uterus","VGLL4","PRKG1","VGLL4","PRKG1","PRKG1","AGC","5592","Q13976","NM_006258.4","NM_006258.4",NULL,NULL,"F360-F619",NULL,"NM_001128219.3","NM_001128219.3","VGLL4-PRKG1","3p25.3-p","10q11.23-q21","1","3","159","ATAGCCCTCATGTCAGCGCTGCCGGCTTGCAGCGGGCTGTGAGAGGGGCCGGCGCCGCTTTGTCCTAGGAAACGGGCTGCGCGTTTCTCTTTTTCACTCTTTTCCATTTCCAGGAAGGACTTGTAAGGACTTCTGAAACGCTGTTTTCATACTCGATCGGGGATACAGTACATACACCGTCTACCAGTAAGCCCTTGAAGGGTTTCGTGTGAGCTCGATTTTTTTGTGCCTGATTTTTTTTTTTTTAACTTTTGCATACTTTGTTTTGATAGTCTGAGGCTGGGCCTCTGCCTTTGTGAAGTTGAAGAGCCAGGAGCTACTCAGCAACAATTGATTTTTGAAACTTAACTCTTTTGGGGCAAAAGCAAAGAGCTGGTTTTCTTTGCTAGCCCAATAAATGCTATTTATGAAGATGGACCTGTTGAACTATCAGTACTTGGACAAGATGAACAACAATATCGGCATTCTGTGCTACGAAG","ATGGTAAGGTTGAAGTTACAAAAGAAGGTGTGAAGTTGTGTACCATGGGTCCAGGAAAAGTGTTTGGGGAATTGGCTATTCTTTACAACTGTACCCGGACAGCGACCGTCAAGA","554","translocation",NULL,"NGS, RT-PCR, Sanger sequencing, Western blot","N",NULL,"25485619, 26689674",NULL,NULL,NULL
"108","MDA-MB-468","MDA-MB-468","--","Breast","ARID1A","MAST2","ARID1A","MAST2","MAST2","AGC","23139","Q6P0Q8","NM_015112.3","NM_015112.3",NULL,NULL,"F512-F785",NULL,"NM_006015.6","NM_006015.6","ARID1A-MAST2","1p36.11","1p34.1","1","2","59","CTCCTTTCTCCGGCAGCAGAAAGCGGAGAGTCACAGCGGGGCCAGGCCCTGGGGAGCGGAGCCTCCACCGCCCCCCTCATTCCCAGGCAAGGGCTTGGGGGGAATGAGCCGGGAGAGCCGGGTCCCGAGCCTACAGAGCCGGGAGCAGCTGAGCCGCCGGCGCCTCGGCCGCCGCCGCCGCCTCCTCCTCCTCCGCCGCCGCCAGCCCGGAGCCTGAGCCGGCGGGGCGGGGGGGAGAGGAGCGAGCGCAGCGCAGCAGCGGAGCCCCGCGAGGCCCGCCCGGGCGGGTGGGGAGGGCAGCCCGGGGGACTGGGCCCCGGGGCGGGGTGGGAGGGGGGGAGAAGACGAAGACAGGGCCGGGTCTCTCCGCGGACGAGACAGCGGGGATCATGGCCGCGCAGGTCGCCCCCGCCGCCGCCAGCAGCCTGGGCAACCCGCCGCCGCCGCCGCCCTCGGAGCTGAAGAAAGCCGAGCAGCAGCAGCGGGAGGAGGCGGGGGGCGAGGCGGCGGCGGCGGCAGCGGCCGAGCGCGGGGAAATGAAGGCAGCCGCCGGGCAGGAAAGCGAGGGCCCCGCCGTGGGGCCGCCGCAGCCGCTGGGAAAGGAGCTGCAGGACGGGGCCGAGAGCAATGGGGGTGGCGGCGGCGGCGGAGCCGGCAGCGGCGGCGGGCCCGGCGCGGAGCCGGACCTGAAGAACTCGAACGGGAACGCGGGCCCTAGGCCCGCCCTGAACAATAACCTCACGGAGCCGCCCGGCGGCGGCGGTGGCGGCAGCAGCGATGGGGTGGGGGCGCCTCCTCACTCAGCCGCGGCCGCCTTGCCGCCCCCAGCCTACGGCTTCGGGCAACCCTACGGCCGGAGCCCGTCTGCCGTCGCCGCCGCCGCGGCCGCCGTCTTCCACCAACAACATGGCGGACAACAAAGCCCTGGCCTGGCAGCGCTGCAGAGCGGCGGCGGCGGGGGCCTGGAGCCCTACGCGGGGCCCCAGCAGAACTCTCACGACCACGGCTTCCCCAACCACCAGTACAACTCCTACTACCCCAACCGCAGCGCCTACCCCCCGCCCGCCCCGGCCTACGCGCTGAGCTCCCCGAGAGGTGGCACTCCGGGCTCCGGCGCGGCGGCGGCTGCCGGCTCCAAGCCGCCTCCCTCCTCCAGCGCCTCCGCCTCCTCGTCGTCTTCGTCCTTCGCTCAGCAGCGCTTCGGGGCCATGGGGGGAGGCGGCCCCTCCGCGGCCGGCGGGGGAACTCCCCAGCCCACCGCCACCCCCACCCTCAACCAACTGCTCACGTCGCCCAGCTCGGCCCGGGGCTACCAGGGCTACCCCGGGGGCGACTACAGTGGCGGGCCCCAGGACGGGGGCGCCGGCAAGGGCCCGGCGGACATGGCCTCGCAGTGTTGGGGGGCTGCGGCGGCGGCAGCTGCGGCGGCGGCCGCCTCGGGAGGGGCCCAACAAAGGAGCCACCACGCGCCCATGAGCCCCGGGAGCAGCGGCGGCGGGGGGCAGCCGCTCGCCCGGACCCCTCAG","GATGTAGTAACTGGAGTTAGTCCCCTGCTCTTCAGGAAACTCAGTAATCCTGACATATTTTCATCCACTGGAAAAGTTAAACTTCAGCGACAACTGAGTCAGGATGATTGTAAGTTATGGAGAGGAAACCTGGCCAGCTCTCTATCGG","2118","deletion",NULL,"NGS, RT-PCR, RT-qPCR","N",NULL,"25485619, 31097696, 22101766, 22952423",NULL,NULL,NULL
"109","SUM185PE","SUM 185PE","--","Unknown","FGFR3","TACC3","FGFR3","TACC3","FGFR3","RECEPTOR TK","2261","P22607","NM_001163213 ","NM_001163213 ",NULL,NULL,"L472-L761",NULL,"NM_006342 ","NM_006342","FGFR3-TACC3","4p16.3","4p16.3","17","11","759","GTACATGATCATGCGGGAGTGCTGGCATGCCGCGCCCTCCCAGAGGCCCACCTTCAAGCAGCTGGTGGAGGACCTGGACCGTGTCCTTACCGTGACGTCCACCGAC","GTAAAGGCGACACAGGAGGAGAACCGGGAGCTGAGGAGCAGGTGTGAGGAGCTCCACGGGAAGAACCTGGAACTGGG","951","scramble",NULL,"Western blot","Y","TCGA-06-2567-01A, TCGA-14-0789-01A, TCGA-14-1823-01A, TCGA-14-1829-01A, TCGA-22-4607-01A, TCGA-27-1835-01A, TCGA-34-2608-01A, TCGA-38-4630-01A, TCGA-39-5024-01A, TCGA-63-7022-01A, TCGA-66-2786-01A, TCGA-76-4925-01A, TCGA-92-8065-01A, TCGA-A4-7287-01A, TCGA-CF-A3MF-01A, TCGA-CF-A3MG-01A, TCGA-CF-A3MH-01A, TCGA-CF-A47S-01A, TCGA-CF-A47T-01A, TCGA-CF-A8HY-01A, TCGA-CR-6473-01A, TCGA-CV-7100-01A, TCGA-DD-A1EK-01A, TCGA-DS-A3LQ-01A, TCGA-DW-7839-01A, TCGA-E7-A5KE-01A, TCGA-FG-7643-01A, TCGA-LN-A5U5-01A, TCGA-LN-A9FO-01A, TCGA-LP-A7HU-01A, TCGA-P5-A72U-01A, TCGA-VS-A9UD-01A, TCGA-WL-A834-01A, TCGA-XF-AAMX-01A, TCGA-XF-AAMZ-01A, TCGA-ZJ-AAXT-01A","31987043
",NULL,NULL,NULL
"2","23153582","Identification of a novel crosstalk between casein kinase 2alpha and","It was previously reported that beta-catenin contributes to the tumorigenesis of ALK-positive anaplastic large cell lymphoma (ALK(+)ALCL), and the oncogenic effects of beta-catenin in these tumors are promoted by NPM-ALK, an abnormal fusion protein characteristic of ALK(+)ALCL. In this study, we hypothesized that NPM-ALK promotes the oncogenic activity of beta-catenin via its functional interactions with the Wnt canonical pathway (WCP). To test this hypothesis, we examined if NPM-ALK modulates the gene expression of various members in the WCP. Using a Wnt pathway-specific oligonucleotide array and Western blots, we found that the expression of casein kinase 2alpha (CK2alpha) was substantially downregulated in ALK(+)ALCL cells in response to siRNA knockdown of NPM-ALK. CK2alpha is biologically important in ALK(+)ALCL, as its inhibition using 4,5,6,7-tetrabromobenzotriazole or siRNA resulted in a","Casein Kinase II/antagonists & inhibitors/*metabolism, Cell Communication/drug effects, Cell Line, Tumor, Cell Proliferation/drug effects, Cell Transformation, Neoplastic, Down-Regulation/drug effects, Enzyme Inhibitors/pharmacology, Humans, Lymphoma, Large-Cell, Anaplastic/metabolis","Armanious H, Gelebart P, Anand M, Lai R","Cell Signal. 2013 Feb;25(2):381-8. doi","2013 Feb","S0898-6568(12)00308-7 [pii], 10.1016/j.cellsig.2012.11.005 [doi]","Cellular signalling"
"3","20073070","ABL1 rearrangements in T-cell acute lymphoblastic leukemia.","T-cell acute lymphoblastic leukemia (T-ALL) is the result of multiple oncogenic insults of thymocytes. Recently, new ABL1 fusion genes have been identified that provide proliferation and survival advantage to lymphoblasts. These are the NUP214-ABL1 fusion gene, on amplified episomes, the unique case of EML1-ABL1 fusion due to a cryptic t(9;14)(q34;q32) and the seldom reported BCR-ABL1 and ETV6-ABL1 chimeric genes. The most frequent and strictly associated with T-ALL is the NUP214-ABL1 fusion identified in 6% of cases, in both children and adults. Patients present with classical T-ALL features. Cytogenetically, the fusion is cryptic but seen by FISH on amplified episomes or more rarely as a small hsr. The ABL1 fusion is a late event associated with other genetic alterations like NOTCH1 activating mutation, deletion of CDKN2A locus, and ectopic expression of TLX1 or TLX3. The mechanism of activat","Adolescent, Adult, Aged, Child, Child, Preschool, Chromosome Aberrations, Female, *Gene Rearrangement, Humans, Male, Middle Aged, Oncogene Proteins, Fusion/*genetics, Precursor T-Cell Lymphoblastic Leukemia-Lymphoma/*genetics, Proto-Oncogene Proteins c-abl/*genetics","Hagemeijer A, Graux C","Genes Chromosomes Cancer. 2010 Apr;49(4):299-308. doi","2010 Apr","10.1002/gcc.20743 [doi]","Genes, chromosomes & cancer"
"4","28123544","Molecular heterogeneity in the novel fusion gene APIP-FGFR2","Several novel fusion transcripts were identified by next-generation sequencing in gastric cancer; however, the breakpoint junctions have yet to be characterized. The present study characterized a plethora of APIP-FGFR2 genomic breakpoints in the SNU-16 gastric cancer cell line, which harbored homogeneously staining regions (hsrs) and double minute chromosomes. Oligonucleotide microarrays revealed high-level amplifications at chromosomes 8q24.1 (0.8 Mb region), 10q26 (1.1 Mb) and 11p13 (1.1 Mb). These amplicons contained MYC and PVT1 at chromosome 8q24.1, BRWD2, FGFR2 and ATE1 at chromosome 10q26, and 24 genes, including APIP, CD44, RAG1 and RAG2, at chromosome 11p13. Based on these findings, reverse transcription-polymerase chain reaction (PCR) was performed using various candidate gene primers to detect possible fusion transcripts, and several products using primer sets for the APIP and FGFR2 ","?","Okuda T, Taki T, Nishida K, Chinen Y, Nagoshi H, Sakakura C, Taniwaki M","Oncol Lett. 2017 Jan;13(1):215-221. doi","2017 Jan","10.3892/ol.2016.5386 [doi], OL-0-0-5386 [pii]","Oncology letters"
"5","24373969","FuseFISH","Transcribed gene fusions are key biomarkers in many hematologic and solid tumors, often representing the primary oncogenic driver mutation. Here, we report an experimental and computational pipeline for detecting fusion transcripts using single-molecule RNA FISH and unbiased correlation analysis (FuseFISH). We constructed a genome-wide database of optimal oligonucleotide sequences, enabling quick design of FuseFISH probes against known and novel fusions. We implemented FuseFISH in cell lines, tissue sections, and purified RNA, reliably detecting one BCR-ABL1 positive in 10,000 negative cells. In 34 hematologic samples, we detected BCR-ABL1 transcripts with high specificity and sensitivity. Finally, we measured BCR-ABL1 expression heterogeneity and dynamics in single CML cells exposed to the kinase inhibitor Nilotinib. Our resource and methods are ideal for streamlined validation of fusions newl","Cell Line, Tumor, Computational Biology/methods, Databases, Nucleic Acid, Fusion Proteins, bcr-abl/genetics/*metabolism, *Genome, Human, Humans, In Situ Hybridization, Fluorescence/*methods, RNA, Messenger/genetics/*metabolism, Transcription, Genetic","Semrau S, Crosetto N, Bienko M, Boni M, Bernasconi P, Chiarle R, van Oudenaarden A","Cell Rep. 2014 Jan 16;6(1):18-23. doi","2014 Jan","S2211-1247(13)00732-8 [pii], 10.1016/j.celrep.2013.12.002 [doi]","Cell reports"
"6","12759926","High-resolution analysis of acquired genomic imbalances in bone marr","Chronic myeloid leukemia (CML) is a biphasic hematopoietic malignancy associated with a single cytogenetic aberration, the Philadelphia translocation t(9;22)(q34;q11), resulting in the BCR-ABL1 fusion oncogene. Molecular heterogeneity was recently demonstrated in the form of extensive deletion of chromosomes 9 and 22 material from the der(9)t(9;22) in 15% of CML patients. The deletions were associated with a worse disease prognosis. Further genetic heterogeneity is seen during the terminal blast crisis stage of CML, in the form of additional non-random chromosome abnormalities. These include most frequently an extra copy of the Ph chromosome, trisomy 8, and isochromosome 17q. We used the genetic heterogeneity of CML as a framework to explore a new technique for high-throughput assessment of locus copy number in malignancy. Multiplex amplifiable probe hybridization (MAPH) relies on the ability o","Allelic Imbalance/*genetics, Bone Marrow Cells/*pathology, Chromosome Aberrations, Chromosome Deletion, Clone Cells, Cytogenetic Analysis/*methods, DNA Probes/*genetics, Fusion Proteins, bcr-abl/genetics, Gene Amplification/genetics, Humans, In Situ Hybridization, Fluorescence/method","Reid AG, Tarpey PS, Nacheva EP","Genes Chromosomes Cancer. 2003 Jul;37(3):282-90. doi","2003 Jul","10.1002/gcc.10215 [doi]","Genes, chromosomes & cancer"
"7","8609723","KBM-7, a human myeloid leukemia cell line with double Philadelphia c","A human myeloid leukemia cell line, KBM-7, was developed from a patient in the blastic phase of chronic myeloid leukemia (CML). We characterized its morphology, immunophenotype, cytogenetics, and proliferative capacity. Developed in the absence of exogenous lymphokines, KBM-7 in vitro cloning capacity actually decreased when colony-stimulating factors were added. The cells had an aberrant immature myeloid phenotype, a doubling time of 22 h in suspension cultures and a high cloning efficiency in semisolid system (24 +/- 3)%. Early passages contained one near-haploid (predominant) and one hyperdiploid stem line. Gradually the hyperdiploid stem line became predominant, reaching an average of 49 chromosomes per cell. Cells from passage 89 had two Philadelphia chromosomes [t(9;22)(q34;q11)] and lacked normal copies of chromosomes 9 and 22. Detailed molecular characterization of the breakpoint in the","Animals, Base Sequence, Cell Division, Fusion Proteins, bcr-abl/*genetics/metabolism, Humans, Karyotyping, Leukemia, Myeloid/*genetics/metabolism, Mice, Mice, Nude, Molecular Sequence Data, Neoplasm Transplantation, Oncogene Proteins/*genetics/metabolism, *Philadelphia Chromosome, *P","Andersson BS, Collins VP, Kurzrock R, Larkin DW, Childs C, Ost A, Cork A, Trujillo JM, Freireich EJ, Siciliano MJ, et al.","Leukemia. 1995 Dec;9(12):2100-8.","1995 Dec","?","Leukemia"
"8","11908723","Characterization of a novel human anaplastic large cell lymphoma cel","L82, a novel anaplastic large cell lymphoma (ALCL) cell line was established from the pleural effusion of a 24-year-old patient with recurrent ALCL. L82 cells showed the typical morphologic features of ALCL cells with irregular, often indented, nuclear profiles, prominent nucleoli, and abundant cytoplasm. The immunoprofile of L82 corresponds to that seen typically in primary ALCL cells, with positivity for CD30, EMA, CD3, CD4, CD25, CD71, TIA1, and granzyme B; the cells were negative for EBV-related antigens. Cytogenetic analysis showed a complex, near triploid karyotype with 72-77 chromosomes, including the ALCL specific translocation t(2;5)(p23;q35). Chromosomal analysis revealed a number of secondary structural alterations including amplification of 7q21-31, 1q, and 6p, and gain of chromosomal material in 8q (affecting the c-myc gene). The rearrangement of the T-cell receptor-gamma locus sho","Adult, Animals, Chromosome Aberrations, Cytogenetic Analysis, Cytokines/analysis, Disease Models, Animal, Female, Humans, Immunophenotyping, Lymphoma, Large B-Cell, Diffuse/genetics/immunology/*pathology, Lymphoma, T-Cell/genetics/immunology/pathology, Mice, Mice, SCID, Pleural Effus","Merz H, Lange K, Gaiser T, Muller A, Kapp U, Bittner C, Harder S, Siebert R, Bentz M, Binder T, Diehl V, Feller AC","Leuk Lymphoma. 2002 Jan;43(1):165-72. doi","2002 Jan","10.1080/10428190210193 [doi]","Leukemia & lymphoma"
"9","29608815","Alkynylnicotinamide-Based Compounds as ABL1 Inhibitors with Potent A","The introduction of imatinib into the clinical scene revolutionized the treatment of chronic myelogenous leukemia (CML). The overall eight-year survival rate for CML has increased from about 6 % in the 1970s to over 90 % in the imatinib era. However, about 20 % of CML patients harbor primary or acquired resistance to tyrosine kinase inhibitors. ABL1 point mutations in the BCR-ABL1 fusion protein, such as ABL1(T315I), typically emerge after prolonged kinase inhibitor treatment. Ponatinib (AP24534) is currently the only approved CML drug that is active against the ABL1(T315I) mutation. However, ponatinib has severe cardiovascular toxicities; hence, there have been efforts to find safer CML drugs that work against ABL1 secondary mutations. We reveal that isoquinoline- or naphthyridine-based compounds, such as HSN431, HSN576, HSN459, and HSN608 potently inhibit the enzymatic activities of ABL1, ABL","Alkynes/chemical synthesis/chemistry/*pharmacology, Animals, Antineoplastic Agents/chemical synthesis/chemistry/*pharmacology, Cell Line, Tumor, Humans, Imatinib Mesylate/pharmacology, Imidazoles/pharmacology, Isoquinolines/chemical synthesis/chemistry/pharmacology, Leukemia, Myeloge","Larocque EA, Naganna N, Opoku-Temeng C, Lambrecht AM, Sintim HO","ChemMedChem. 2018 Jun 20;13(12):1172-1180. doi","2018 Jun","10.1002/cmdc.201700829 [doi]","ChemMedChem"
"10","24218589","Foretinib is a potent inhibitor of oncogenic ROS1 fusion proteins.","The rapidly growing recognition of the role of oncogenic ROS1 fusion proteins in the malignant transformation of multiple cancers, including lung adenocarcinoma, cholangiocarcinoma, and glioblastoma, is driving efforts to develop effective ROS1 inhibitors for use as molecularly targeted therapy. Using a multidisciplinary approach involving small molecule screening in combination with in vitro and in vivo tumor models, we show that foretinib (GSK1363089) is a more potent ROS1 inhibitor than crizotinib (PF-02341066), an ALK/ROS inhibitor currently in clinical evaluation for lung cancer patients harboring ROS1 rearrangements. Whereas crizotinib has demonstrated promising early results in patients with ROS1-rearranged non-small-cell lung carcinoma, recently emerging clinical evidence suggests that patients may develop crizotinib resistance due to acquired point mutations in the kinase domain of ROS","Anilides/*pharmacology, Animals, Base Sequence, Cell Line, Tumor, Cell Survival/drug effects, DNA Primers/genetics, Flow Cytometry, Mice, Molecular Sequence Data, Mutagenesis, Oncogenes/*genetics, Proto-Oncogene Proteins/*antagonists & inhibitors/genetics, Quinolines/*pharmacology, R","Davare MA, Saborowski A, Eide CA, Tognon C, Smith RL, Elferich J, Agarwal A, Tyner JW, Shinde UP, Lowe SW, Druker BJ","Proc Natl Acad Sci U S A. 2013 Nov 26;110(48):19519-24. doi","2013 Nov","1319583110 [pii], 10.1073/pnas.1319583110 [doi]","Proceedings of the National Academy of Sciences of the United States of America"
"11","25359993","Essential role of IRF4 and MYC signaling for survival of anaplastic ","Anaplastic large cell lymphoma (ALCL) is a distinct entity of T-cell lymphoma that can be divided into 2 subtypes based on the presence of translocations involving the ALK gene (ALK(+) and ALK(-) ALCL). The interferon regulatory factor 4 (IRF4) is known to be highly expressed in both ALK(+) and ALK(-) ALCLs. However, the role of IRF4 in the pathogenesis of these lymphomas remains unclear. Here we show that ALCLs of both subtypes are addicted to IRF4 signaling, as knockdown of IRF4 by RNA interference was toxic to ALCL cell lines in vitro and in ALCL xenograft mouse models in vivo. Gene expression profiling after IRF4 knockdown demonstrated a significant downregulation of a variety of known MYC target genes. Furthermore, our analyses revealed that MYC is a primary target of IRF4, identifying a novel regulatory mechanism of MYC expression and its target gene network in ALCL. MYC, itself, is essen","Animals, Cell Line, Tumor, Cell Survival, Female, Gene Expression Profiling, *Gene Expression Regulation, Neoplastic, Humans, Interferon Regulatory Factors/*metabolism, Lymphoma/metabolism, Lymphoma, Large-Cell, Anaplastic/*genetics/*metabolism, Mice, Mice, Inbred NOD, Mice, SCID, Ne","Weilemann A, Grau M, Erdmann T, Merkel O, Sobhiafshar U, Anagnostopoulos I, Hummel M, Siegert A, Hayford C, Madle H, Wollert-Wulf B, Fichtner I, Dorken B, Dirnhofer S, Mathas S, Janz M, Emre NC, Rosenwald A, Ott G, Lenz P, Tzankov A, Lenz G","Blood. 2015 Jan 1;125(1):124-32. doi","2015 Jan","blood-2014-08-594507 [pii], 10.1182/blood-2014-08-594507 [doi]","Blood"
"12","26459174","Bias-Corrected Targeted Next-Generation Sequencing for Rapid, Multip","PURPOSE: Tumor genotyping is a powerful tool for guiding non-small cell lung cancer (NSCLC) care; however, comprehensive tumor genotyping can be logistically cumbersome. To facilitate genotyping, we developed a next-generation sequencing (NGS) assay using a desktop sequencer to detect actionable mutations and rearrangements in cell-free plasma DNA (cfDNA). EXPERIMENTAL DESIGN: An NGS panel was developed targeting 11 driver oncogenes found in NSCLC. Targeted NGS was performed using a novel methodology that maximizes on-target reads, and minimizes artifact, and was validated on DNA dilutions derived from cell lines. Plasma NGS was then blindly performed on 48 patients with advanced, progressive NSCLC and a known tumor genotype, and explored in two patients with incomplete tumor genotyping. RESULTS: NGS could identify mutations present in DNA dilutions at >/= 0.4% allelic frequency with 100% sensi","Carcinoma, Non-Small-Cell Lung/*blood/genetics/secondary, Cell Line, Tumor, DNA Mutational Analysis, DNA, Neoplasm/*blood/genetics, Female, High-Throughput Nucleotide Sequencing, Humans, Lung Neoplasms/*blood/genetics/pathology, Male, Middle Aged, Neoplasm Staging","Paweletz CP, Sacher AG, Raymond CK, Alden RS', ""O'Connell A"", 'Mach SL, Kuang Y, Gandhi L, Kirschmeier P, English JM, Lim LP, Janne PA, Oxnard GR","Clin Cancer Res. 2016 Feb 15;22(4):915-22. doi","2016 Feb","1078-0432.CCR-15-1627-T [pii], 10.1158/1078-0432.CCR-15-1627-T [doi]","Clinical cancer research"
"13","25135958","RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion","Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of M","Adolescent, Adult, Aged, Antineoplastic Agents, Alkylating, Blotting, Western, Brain Neoplasms/*genetics/pathology/secondary, Cell Line, Tumor, Chemoradiotherapy, Dacarbazine/analogs & derivatives/therapeutic use, Female, Gene Expression Regulation, Neoplastic, Glioblastoma/*genetics","Bao ZS, Chen HM, Yang MY, Zhang CB, Yu K, Ye WL, Hu BQ, Yan W, Zhang W, Akers J, Ramakrishnan V, Li J, Carter B, Liu YW, Hu HM, Wang Z, Li MY, Yao K, Qiu XG, Kang CS, You YP, Fan XL, Song WS, Li RQ, Su XD, Chen CC, Jiang T","Genome Res. 2014 Nov;24(11):1765-73. doi","2014 Nov","gr.165126.113 [pii], 10.1101/gr.165126.113 [doi]","Genome research"
"14","8339266","Biological properties and growth in SCID mice of a new myelogenous l","The establishment and the biological properties of a new leukemic cell line (KBM-5) derived from a patient in the blastic phase of chronic myelogenous leukemia are described. The cells exhibited multiple copies of the Philadelphia chromosome, and a high level of p210Bcr-Abl kinase activity was detected with rabbit anti-Abl and anti-Bcr (exon 3) peptide antisera. Use of specific primers and polymerase chain reaction followed by Southern blotting revealed that KBM-5 cells carried a bcr3-ABLII splice junction. While a normal BCR message was detected, no normal ABL message was found. The cells were phenotypically myeloid with monocytic differentiation. The high cloning efficiency in semisolid media was independent of the presence of exogenous colony-stimulating factors. In vitro exposure to induces of differentiation, such as retinoic acid, dimethyl sulfoxide, or hemin, failed to influence the grow","Aged, Animals, Base Sequence, Blast Crisis/*pathology, Cell Differentiation/drug effects, Chromosome Aberrations, Cytokines/genetics, Female, Fusion Proteins, bcr-abl/analysis/genetics, Humans, Isoenzymes/analysis, Killer Cells, Natural/immunology, Leukemia, Myelogenous, Chronic, BCR","Beran M, Pisa P', ""O'Brien S"", 'Kurzrock R, Siciliano M, Cork A, Andersson BS, Kohli V, Kantarjian H","Cancer Res. 1993 Aug 1;53(15):3603-10.","1993 Aug","?","Cancer research"
"15","19240172","Triptolide inhibits Bcr-Abl transcription and induces apoptosis in S","PURPOSE: Resistance to STI571 is an emerging problem for patients with chronic myelogenous leukemia (CML). Mutation in the kinase domain of Bcr-Abl is the predominant mechanism of the acquired resistance to STI571. In the present study, we investigated the effect of triptolide on cell survival or apoptosis in CML cells bearing Bcr-Abl-T315I or wild-type Bcr-Abl. EXPERIMENTAL DESIGN: CML cell lines (KBM5 versus KBM5-T315I, BaF3-Bcr-Abl versus BaF3-Bcr-Abl-T315I) and primary cells from CML patients with clinical resistance to STI571 were treated with triptolide, and analyzed in terms of growth, apoptosis, and signal transduction. Nude mouse xenograft model was also used to evaluate the antitumor activity. RESULTS: Triptolide potently down-regulated the mRNA and protein levels of Bcr-Abl independently of the caspase or proteosome activation in CML cells. It induced mitochondrial-dependent apoptosi","Adolescent, Adult, Aged, Animals, Antineoplastic Agents, Alkylating/therapeutic use, Apoptosis/*drug effects, Benzamides, Blotting, Western, Cell Cycle/drug effects, Cell Proliferation/drug effects, Diterpenes/*therapeutic use, Drug Resistance, Neoplasm, Epoxy Compounds/therapeutic u","Shi X, Jin Y, Cheng C, Zhang H, Zou W, Zheng Q, Lu Z, Chen Q, Lai Y, Pan J","Clin Cancer Res. 2009 Mar 1;15(5):1686-97. doi","2009 Mar","1078-0432.CCR-08-2141 [pii], 10.1158/1078-0432.CCR-08-2141 [doi]","Clinical cancer research"
"16","25502629","Activated MET acts as a salvage signal after treatment with alectini","Non-small cell lung cancer (NSCLC) carrying echinoderm microtubule-associated protein-like 4 (EML4)-anaplastic lymphoma kinase (ALK) rearrangements is hypersensitive to ALK inhibitors, including crizotinib and alectinib. Crizotinib was initially designed as a MET inhibitor, whereas alectinib is a selective ALK inhibitor. The MET signal, which is inhibited by crizotinib but not by alectinib, is dysregulated in many human cancers. However, the role of the MET signal in ALK-positive NSCLC remains unclear. In this study, we found that hepatocyte growth factor (HGF), ligand of MET, mediated the resistance to alectinib, but not to crizotinib, via the MET signal in ALK-positive NSCLC cell lines (H3122 and H2228 cell lines). In addition, alectinib activated the MET signal even in the absence of HGF and the inhibition of the MET signal enhanced the efficacy of alectinib. These findings suggest that acti","Anaplastic Lymphoma Kinase, Carbazoles/*pharmacology, Carcinoma, Non-Small-Cell Lung/*drug therapy/metabolism, Cell Line, Tumor/drug effects, Crizotinib, Drug Resistance, Neoplasm/drug effects, Hepatocyte Growth Factor/metabolism/pharmacology, Humans, Lung Neoplasms/*drug therapy/met","Kogita A, Togashi Y, Hayashi H, Banno E, Terashima M, De Velasco MA, Sakai K, Fujita Y, Tomida S, Takeyama Y, Okuno K, Nakagawa K, Nishio K","Int J Oncol. 2015 Mar;46(3):1025-30. doi","2015 Mar","10.3892/ijo.2014.2797 [doi]","International journal of oncology"
"17","28675026","Crizotinib in Combination with Everolimus Synergistically Inhibits P","PURPOSE: Anaplastic large cell lymphoma (ALCL) is a rare aggresive non-Hodgkin lymphoma, of which over 50% of cases have an aberrant nucleophosmin (NPM)anaplastic lymphoma kinase (ALK) fusion protein. Both mechanistic target of rapamycin (mTOR) inhibitor everolimus and ALK inhibitor crizotinib have shown promising antitumor activity in ALK-positive cancer cell lines. However, their combined effect has not yet been investigated. MATERIALS AND METHODS: We evaluated the anti-proliferative effects of everolimus and/or crizotinib in ALK-positive ALCL cell lines, Karpas 299 and SU-DHL-1, and lung adenocarcinoma cell line, NCI-H2228. RESULTS: We found that individually, both everolimus and crizotinib potently inhibited cell growth in a dose-dependent manner in both Karpas 299 and SU-DHL-1 cells. A combination of these agents synergistically inhibited proliferation in the two cell lines. Crizotinib dow","Anaplastic Lymphoma Kinase, Animals, Crizotinib, Drug Synergism, Everolimus/pharmacology/*therapeutic use, Humans, Immunohistochemistry, Lymphoma, Large-Cell, Anaplastic/*drug therapy/pathology, Mice, Protein Kinase Inhibitors/pharmacology/*therapeutic use, Pyrazoles/pharmacology/*th","Xu W, Kim JW, Jung WJ, Koh Y, Yoon SS","Cancer Res Treat. 2018 Apr;50(2):599-613. doi","2018 Apr","crt.2016.357 [pii], 10.4143/crt.2016.357 [doi]","Cancer research and treatment"
"18","23872305","NUP214-ABL1-mediated cell proliferation in T-cell acute lymphoblasti","The NUP214-ABL1 fusion protein is a constitutively active protein tyrosine kinase that is found in 6% of patients with T-cell acute lymphoblastic leukemia and that promotes proliferation and survival of T-lymphoblasts. Although NUP214-ABL1 is sensitive to ABL1 kinase inhibitors, development of resistance to these compounds is a major clinical problem, underlining the need for additional drug targets in the sparsely studied NUP214-ABL1 signaling network. In this work, we identify and validate the SRC family kinase LCK as a protein whose activity is absolutely required for the proliferation and survival of T-cell acute lymphoblastic leukemia cells that depend on NUP214-ABL1 activity. These findings underscore the potential of SRC kinase inhibitors and of the dual ABL1/SRC kinase inhibitors dasatinib and bosutinib for the treatment of NUP214-ABL1-positive T-cell acute lymphoblastic leukemia. In ad","Carrier Proteins/genetics/metabolism, Cell Line, Tumor, Cell Proliferation, Gene Knockdown Techniques, Humans, Lymphocyte Specific Protein Tyrosine Kinase p56(lck)/*metabolism, Oncogene Proteins, Fusion/*genetics/*metabolism, Phosphorylation, Precursor T-Cell Lymphoblastic Leukemia-L","De Keersmaecker K, Porcu M, Cox L, Girardi T, Vandepoel R, de Beeck JO, Gielen O, Mentens N, Bennett KL, Hantschel O","Haematologica. 2014 Jan;99(1):85-93. doi","2014 Jan","haematol.2013.088674 [pii], 10.3324/haematol.2013.088674 [doi]","Haematologica"
"19","24070327","Multidrug resistance in chronic myeloid leukaemia","The hallmark of CML (chronic myeloid leukaemia) is the BCR (breakpoint cluster region)-ABL fusion gene. CML evolves through three phases, based on both clinical and pathological features: a chronic phase, an accelerated phase and blast crisis. TKI (tyrosine kinase inhibitors) are the treatment modality for patients with chronic phase CML. The therapeutic potential of the TKI imatinib is affected by BCR-ABL dependent an independent mechanisms. Development of MDR (multidrug resistance) contributes to the overall clinical resistance. MDR involves overexpression of ABC -transporters (ATP-binding-cassette transporter) among other features. MDR studies include the analysis of cancer cell lines selected for resistance. CML blast crisis is accompanied by increased resistance to apoptosis. This work reviews the role played by the influx transporter OCT1 (organic cation transporter 1), by efflux ABC tran","ATP-Binding Cassette Transporters/metabolism, Animals, Antineoplastic Agents/*pharmacology, Apoptosis Regulatory Proteins/metabolism, Calcium Signaling, Cell Line, Tumor, Cytoskeleton/metabolism, Drug Resistance, Multiple, *Drug Resistance, Neoplasm, Drug Screening Assays, Antitumor,","Rumjanek VM, Vidal RS, Maia RC","Biosci Rep. 2013 Nov 25;33(6). pii","2013 Nov","BSR20130067 [pii], 10.1042/BSR20130067 [doi]","Bioscience reports"
"20","25120641","NUP214 fusion genes in acute leukemia (Review).","Nucleoporin 214 (NUP214), previously termed CAN, is required for cell cycle and nucleocytoplasmic transport. The genetic features and clinical implications of five NUP214-associated fusion genes are described in this review. SET-NUP214 was most frequently observed in T-cell acute lymphoblastic leukemia (T-ALL), concomitant with the elevated expression of HOXA cluster genes. Furthermore, the fusion transcript may be regarded as a potential minimal residual disease marker for SET-NUP214-positive patients. Episomal amplifications of NUP214-ABL1 are specific to T-ALL patients. The NUP214-ABL1 gene is observed in ~6% of T-ALL, in children and adults. Targeted tyrosine kinase inhibitors plus standard chemotherapy appear to present a promising treatment strategy. DEK-NUP214 is formed by the fusion of exon 2 of DEK and exon 6 of NUP214. Achieving molecular negativity of DEK-NUP214 is of great importanc","?","Zhou MH, Yang QM","Oncol Lett. 2014 Sep;8(3):959-962. doi","2014 Sep","10.3892/ol.2014.2263 [doi], ol-08-03-0959 [pii]","Oncology letters"
"21","7873501","Establishment of multiple leukemia cell lines with diverse myeloid a","Seven cell lines, MOLM-6, -7, -8, -9, -10, -11 and -12, were established from a single blood sample from a patient with chronic myelogenous leukemia (CML) in blastic phase having the Ph1 chromosome abnormality. Based on immunophenotyping, two of these seven cell lines, MOLM-7 and -11, represented the megakaryoblastoid lineage, and the other five cell lines represented two different maturation stages of the myeloid lineage.","Adult, Bone Marrow/pathology, *Cell Line, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*pathology, Male, Megakaryocytes/pathology, Tumor Cells, Cultured","Tsuji-Takayama K, Kamiya T, Nakamura S, Matsuo Y, Adachi T, Tsubota T, Imanishi J, Minowada J","Hum Cell. 1994 Sep;7(3):167-71.","1994 Sep","?","Human cell"
"22","27748748","Recurrent MET fusion genes represent a drug target in pediatric glio","Pediatric glioblastoma is one of the most common and most deadly brain tumors in childhood. Using an integrative genetic analysis of 53 pediatric glioblastomas and five in vitro model systems, we identified previously unidentified gene fusions involving the MET oncogene in approximately 10% of cases. These MET fusions activated mitogen-activated protein kinase (MAPK) signaling and, in cooperation with lesions compromising cell cycle regulation, induced aggressive glial tumors in vivo. MET inhibitors suppressed MET tumor growth in xenograft models. Finally, we treated a pediatric patient bearing a MET-fusion-expressing glioblastoma with the targeted inhibitor crizotinib. This therapy led to substantial tumor shrinkage and associated relief of symptoms, but new treatment-resistant lesions appeared, indicating that combination therapies are likely necessary to achieve a durable clinical response.","Adolescent, Adult, Anilides/pharmacology, Animals, Brain Neoplasms/drug therapy/*genetics, Cell Line, Tumor, Child, Child, Preschool, Crizotinib, DNA, Neoplasm, Female, Glioblastoma/drug therapy/*genetics, Humans, Infant, Male, Mice, Mice, SCID, Microtubule-Associated Proteins/geneti","?","Nat Med. 2016 Nov;22(11):1314-1320. doi","2016 Nov","nm.4204 [pii], 10.1038/nm.4204 [doi]","Nature medicine"
"23","18784740","Intrinsic differences between the catalytic properties of the oncoge","The NUP214-ABL1 fusion kinase has recently been identified in 6% of patients with T-cell acute lymphoblastic leukemia. In contrast to the more common oncogenic ABL1 fusion BCR-ABL1, NUP214-ABL1 localizes to the nuclear pore complexes and has attenuated transforming properties in hematopoietic cells and in mouse bone marrow transplant models. We have performed a thorough biochemical comparative analysis of NUP214-ABL1 and BCR-ABL1 and show that, despite their common tyrosine kinase domain, the two fusion proteins differ in many critical catalytic properties. NUP214-ABL1 has lower in vitro tyrosine kinase activity, which is in agreement with the absence of phosphorylation on its activation loop. NUP214-ABL1 was more sensitive to imatinib (Glivec) than BCR-ABL1 in vitro and in cells, indicating a different activation state and conformation of the two ABL1 fusion kinases. Using a peptide array, we ","Benzamides, Dasatinib, Enzyme Activation/physiology, Fusion Proteins, bcr-abl/antagonists & inhibitors/genetics/*metabolism, Gene Expression Regulation, Leukemic, Humans, Imatinib Mesylate, In Vitro Techniques, K562 Cells, Leukemia, Erythroblastic, Acute/genetics/*metabolism, Oncogen","De Keersmaecker K, Versele M, Cools J, Superti-Furga G, Hantschel O","Leukemia. 2008 Dec;22(12):2208-16. doi","2008 Dec","leu2008242 [pii], 10.1038/leu.2008.242 [doi]","Leukemia"
"24","28741662","Molecular breakdown","Most anaplastic lymphoma kinase (ALK)-rearranged non-small cell lung cancers (NSCLCs) show good clinical response to ALK inhibitors. However, some ALK-rearranged NSCLC patients show various primary responses with unknown reasons. Previous studies focused on the clinical aspects of ALK fusions in small cohorts, or were conducted in vitro and/or in vivo to investigate the function of ALK. One of the suggested theories describes how echinoderm microtubule-associated protein-like 4 (EML4)-ALK variants play a role towards different sensitivities in ALK inhibitors. Until now, there has been no integrated comprehensive study that dissects ALK at the molecular level in a large scale. Here, we report the largest extensive molecular analysis of 158 ALK-rearranged NSCLCs and have investigated these findings in a cell line construct experiment. We discovered that NSCLCs with EML4-ALK short forms (variant 3","Adult, Aged, Aged, 80 and over, Anaplastic Lymphoma Kinase, Carcinoma, Non-Small-Cell Lung/drug therapy/*enzymology/genetics, Female, Humans, Lung Neoplasms/*enzymology/genetics/*pathology, Male, Microtubule-Associated Proteins/genetics/*metabolism, Middle Aged, Mutation/genetics, On","Noh KW, Lee MS, Lee SE, Song JY, Shin HT, Kim YJ, Oh DY, Jung K, Sung M, Kim M, An S, Han J, Shim YM, Zo JI, Kim J, Park WY, Lee SH, Choi YL","J Pathol. 2017 Nov;243(3):307-319. doi","2017 Nov","10.1002/path.4950 [doi]","The Journal of pathology"
"25","26210452","Signal transduction and downregulation of C-MET in HGF stimulated lo","The poor outcome of osteosarcoma (OS), particularly in patients with metastatic disease and a five-year survival rate of only 20%, asks for more effective therapeutic strategies targeting malignancy-promoting mechanisms. Dysregulation of C-MET, its ligand hepatocyte growth factor (HGF) and the fusion oncogene product TPR-MET, first identified in human MNNG-HOS OS cells, have been described as cancer-causing factors in human cancers. Here, the expression of these molecules at the mRNA and the protein level and of HGF-stimulated signaling and downregulation of C-MET was compared in the parental low metastatic HOS and MG63 cell lines and the respective highly metastatic MNNG-HOS and 143B and the MG63-M6 and MG63-M8 sublines. Interestingly, expression of TPR-MET was only observed in MNNG-HOS cells. HGF stimulated the phosphorylation of Akt and Erk1/2 in all cell lines investigated, but phospho-Stat","Cell Line, Tumor, Down-Regulation/drug effects, Gene Expression Regulation, Neoplastic/drug effects, Hepatocyte Growth Factor/*pharmacology, Humans, Osteosarcoma/*metabolism/pathology/*secondary, Receptor Protein-Tyrosine Kinases/*metabolism, *Signal Transduction","Husmann K, Ducommun P, Sabile AA, Pedersen EM, Born W, Fuchs B","Biochem Biophys Res Commun. 2015 Sep 4;464(4):1222-1227. doi","2015 Sep","S0006-291X(15)30338-7 [pii], 10.1016/j.bbrc.2015.07.108 [doi]","Biochemical and biophysical research communications"
"26","27890856","siRNA-cell-penetrating peptides complexes as a combinatorial therapy","Chronic myeloid leukemia (CML) is a myeloproliferative disorder caused by a single gene mutation, a reciprocal translocation that originates the Bcr-Abl gene with constitutive tyrosine kinase activity. As a monogenic disease, it is an optimum target for RNA silencing therapy. We developed a siRNA-based therapeutic approach in which the siRNA is delivered by pepM or pepR, two cell-penetrating peptides (CPPs) derived from the dengue virus capsid protein. These peptides have a dual role: siRNA delivery into cells and direct action as bioportides, i.e. intracellularly bioactive CPPs, targetting cancer-related signaling processes. Both pepM and pepR penetrate the positive Bcr-Abl(+) Cell Line (BV173). Five in silico designed anti-Bcr-Abl siRNA were selected for in vitro analysis after thorough screening. The Bcr-Abl downregulation kinetics (48h to 168h) was followed by quantitative PCR. The bioporti","Cell Line, Tumor, Cell-Penetrating Peptides/*administration & dosage, Combined Modality Therapy, Fusion Proteins, bcr-abl/*genetics, Gene Knockdown Techniques, *Gene Transfer Techniques, Green Fluorescent Proteins/genetics, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*th","Freire JM, Rego de Figueiredo I, Valle J, Veiga AS, Andreu D, Enguita FJ, Castanho MA","J Control Release. 2017 Jan 10;245:127-136. doi","2017 Jan","S0168-3659(16)31222-6 [pii], 10.1016/j.jconrel.2016.11.027 [doi]","Journal of controlled release"
"27","27068398","An Activating KIT Mutation Induces Crizotinib Resistance in ROS1-Pos","INTRODUCTION: Patients with non-small cell lung cancer (NSCLC) harboring ROS proto-oncogene 1, receptor tyrosine kinase gene (ROS1) chromosomal rearrangements benefit from treatment with the ROS1 inhibitor crizotinib. Limited data exist on the spectrum of resistance mechanisms in ROS1-positive NSCLC. To delineate mechanisms of acquired resistance, we analyzed biopsy samples of tumor lesions that progressed while patients were receiving crizotinib. METHODS: An activating mutation in the KIT proto-oncogene receptor tyrosine kinase (KIT) (p.D816G) was identified by SNaPshot sequencing in a tumor sample from a patient with ROS1-positive NSCLC identified by fluorescence in situ hybridization whose disease progressed after initial response to crizotinib. In vitro studies included evaluation of KIT mRNA expression by quantitative reverse-transcriptase polymerase chain reactions, transduction of Ba/F3 ","Adult, Carcinoma, Non-Small-Cell Lung/chemistry/*drug therapy/genetics, Cell Line, Tumor, Crizotinib, Drug Resistance, Neoplasm, Female, Humans, Lung Neoplasms/chemistry/*drug therapy/genetics, *Mutation, Protein Kinase Inhibitors/*therapeutic use, Protein-Tyrosine Kinases/*analysis/","Dziadziuszko R, Le AT, Wrona A, Jassem J, Camidge DR, Varella-Garcia M, Aisner DL, Doebele RC","J Thorac Oncol. 2016 Aug;11(8):1273-1281. doi","2016 Aug","S1556-0864(16)30083-1 [pii], 10.1016/j.jtho.2016.04.001 [doi]","Journal of thoracic oncology"
"28","25231053","Screening for the FIG-ROS1 fusion in biliary tract carcinomas by nes","ROS1 rearrangements have been detected in a variety of tumors and are considered as suitable targets of anticancer therapies. We developed a new, quick, specific, and sensitive PCR test to screen for the FIG-ROS1 fusion and applied it to a series of Italian patients with bile duct carcinoma (BTC). Formalin-fixed, paraffin-embedded tissues, derived from 65 Italian BTC patients, and six cell lines were analyzed by nested PCR to investigate the prevalence of a previously reported FIG-ROS1 fusion. The specificity and sensitivity of nested PCR were investigated in FIG-ROS1 positive U118MG cells in reconstitution experiments with peripheral blood mononuclear cells. We found that six out of 65 (9%) BTC patients were positive for the FIG-ROS1 fusion, comprising two out of 14 (14%) gallbladder carcinoma (GBC) patients and four out of 25 (16%) extrahepatic cholangiocarcinoma (ECC) patients. None of the 2","Bile Duct Neoplasms/*genetics/pathology, Carcinoma/*pathology, Cell Line, Tumor, Humans, Oncogene Proteins, Fusion/*genetics, Polymerase Chain Reaction, Sensitivity and Specificity","Peraldo Neia C, Cavalloni G, Balsamo A, Venesio T, Napoli F, Sassi F, Martin V, Frattini M, Aglietta M, Leone F","Genes Chromosomes Cancer. 2014 Dec;53(12):1033-40. doi","2014 Dec","10.1002/gcc.22212 [doi]","Genes, chromosomes & cancer"
"29","28581487","EMMPRIN (CD147) is induced by C/EBPbeta and is differentially expres","Anaplastic lymphoma kinase-positive (ALK+) anaplastic large-cell lymphoma (ALCL) is characterized by expression of oncogenic ALK fusion proteins due to the translocation t(2;5)(p23;q35) or variants. Although genotypically a T-cell lymphoma, ALK+ ALCL cells frequently show loss of T-cell-specific surface antigens and expression of monocytic markers. C/EBPbeta, a transcription factor constitutively overexpressed in ALK+ ALCL cells, has been shown to play an important role in the activation and differentiation of macrophages and is furthermore capable of transdifferentiating B-cell and T-cell progenitors to macrophages in vitro. To analyze the role of C/EBPbeta for the unusual phenotype of ALK+ ALCL cells, C/EBPbeta was knocked down by RNA interference in two ALK+ ALCL cell lines, and surface antigen expression profiles of these cell lines were generated using a Human Cell Surface Marker Screening","Anaplastic Lymphoma Kinase, Antigens, CD/analysis/genetics/metabolism, Basigin/analysis/genetics/*metabolism, CCAAT-Enhancer-Binding Protein-beta/genetics/*metabolism, Cell Line, Tumor, Gene Expression Profiling, Gene Expression Regulation, Neoplastic/*genetics, Gene Knockdown Techni","Schmidt J, Bonzheim I, Steinhilber J, Montes-Mojarro IA, Ortiz-Hidalgo C, Klapper W, Fend F, Quintanilla-Martinez L","Lab Invest. 2017 Sep;97(9):1095-1102. doi","2017 Sep","labinvest201754 [pii], 10.1038/labinvest.2017.54 [doi]","Laboratory investigation; a journal of technical methods and pathology"
"30","28650474","An activating mutation of GNB1 is associated with resistance to tyro","Leukemias harboring the ETV6-ABL1 fusion represent a rare subset of hematological malignancies with unfavorable outcomes. The constitutively active chimeric Etv6-Abl1 tyrosine kinase can be specifically inhibited by tyrosine kinase inhibitors (TKIs). Although TKIs represent an important therapeutic tool, so far, the mechanism underlying the potential TKI resistance in ETV6-ABL1-positive malignancies has not been studied in detail. To address this issue, we established a TKI-resistant ETV6-ABL1-positive leukemic cell line through long-term exposure to imatinib. ETV6-ABL1-dependent mechanisms (including fusion gene/protein mutation, amplification, enhanced expression or phosphorylation) and increased TKI efflux were excluded as potential causes of resistance. We showed that TKI effectively inhibited the Etv6-Abl1 kinase activity in resistant cells, and using short hairpin RNA (shRNA)-mediated sil","Cell Line, Tumor, Drug Resistance, Neoplasm/*drug effects, GTP-Binding Protein beta Subunits/*genetics, Humans, Imatinib Mesylate/administration & dosage, Leukemia/*drug therapy/genetics/pathology, Mutation, Oncogene Proteins, Fusion/*genetics, Protein Kinase Inhibitors/administratio","Zimmermannova O, Doktorova E, Stuchly J, Kanderova V, Kuzilkova D, Strnad H, Starkova J, Alberich-Jorda M, Falkenburg JHF, Trka J, Petrak J, Zuna J, Zaliova M","Oncogene. 2017 Oct 26;36(43):5985-5994. doi","2017 Oct","onc2017210 [pii], 10.1038/onc.2017.210 [doi]","Oncogene"
"31","26419961","Efficacy of a Cancer Vaccine against ALK-Rearranged Lung Tumors.","Non-small cell lung cancer (NSCLC) harboring chromosomal rearrangements of the anaplastic lymphoma kinase (ALK) gene is treated with ALK tyrosine kinase inhibitors (TKI), but the treatment is successful for only a limited amount of time; most patients experience a relapse due to the development of drug resistance. Here, we show that a vaccine against ALK induced a strong and specific immune response that both prophylactically and therapeutically impaired the growth of ALK-positive lung tumors in mouse models. The ALK vaccine was efficacious also in combination with ALK TKI treatment and significantly delayed tumor relapses after TKI suspension. We found that lung tumors containing ALK rearrangements induced an immunosuppressive microenvironment, regulating the expression of PD-L1 on the surface of lung tumor cells. High PD-L1 expression reduced ALK vaccine efficacy, which could be restored by a","Anaplastic Lymphoma Kinase, Animals, B7-H1 Antigen/immunology, CD8-Positive T-Lymphocytes/immunology, Cancer Vaccines/*immunology, Carcinoma, Non-Small-Cell Lung/genetics/*therapy, Cell Line, Tumor, Crizotinib, Humans, Lung Neoplasms/genetics/*therapy, Mice, Mice, Inbred BALB C, Mice","Voena C, Menotti M, Mastini C, Di Giacomo F, Longo DL, Castella B, Merlo MEB, Ambrogio C, Wang Q, Minero VG, Poggio T, Martinengo C', ""D'Amico L"", 'Panizza E, Mologni L, Cavallo F, Altruda F, Butaney M, Capelletti M, Inghirami G, Janne PA, Chiarle R","Cancer Immunol Res. 2015 Dec;3(12):1333-1343. doi","2015 Dec","10.1158/2326-6066.CIR-15-0089 [doi]","Cancer immunology research"
"32","3332852","Ph positive CML cell lines.","?","Humans, Karyotyping, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*pathology, Philadelphia Chromosome, Tumor Cells, Cultured/*pathology","Keating A","Baillieres Clin Haematol. 1987 Dec;1(4):1021-9. doi","1987 Dec","10.1016/s0950-3536(87)80037-9 [doi]","Bailliere's clinical haematology"
"33","23434628","Multiplexed deep sequencing analysis of ALK kinase domain identifies","The recently approved ALK kinase inhibitor crizotinib has demonstrated successful treatment of metastatic and late stage ALK fusion positive non-small cell lung cancer (NSCLC). However, the median duration of clinical benefit is ~10-11months due to the emergence of multiple and simultaneous resistance mechanisms in these tumors. Mutations in the ALK kinase domain confer resistance to crizotinib in about one-third of these patients. We developed a multiplex deep sequencing method using semiconductor sequencing technology to quickly detect resistance mutations within the ALK kinase domain from tumor biopsies. By applying a base-pair specific error-weighted mutation calling algorithm (BASCA) that we developed for this assay, genomic DNA analysis from thirteen relapsed patients revealed three known crizotinib resistance mutations, C1156Y, L1196M and G1269A. Our assay demonstrates robust and sensiti","Algorithms, Anaplastic Lymphoma Kinase, Antineoplastic Agents/therapeutic use, Carcinoma, Non-Small-Cell Lung/*drug therapy/enzymology/genetics, Cell Line, Tumor, Crizotinib, Drug Resistance, Neoplasm/*genetics, *High-Throughput Nucleotide Sequencing, Humans, Lung Neoplasms/*drug the","Huang D, Kim DW, Kotsakis A, Deng S, Lira P, Ho SN, Lee NV, Vizcarra P, Cao JQ, Christensen JG, Kim TM, Sun JM, Ahn JS, Ahn MJ, Park K, Mao M","Genomics. 2013 Sep;102(3):157-62. doi","2013 Sep","S0888-7543(13)00034-7 [pii], 10.1016/j.ygeno.2013.02.006 [doi]","Genomics"
"34","20471447","Establishment of a new Philadelphia chromosome-positive acute lympho","OBJECTIVE: The BCR-ABL mutation, T315I, is a common mutation and is resistant to both imatinib and second-generation Abl kinase inhibitors. Although strategies to overcome resistance-mediated T315I mutation may improve the survival of BCR-ABL-positive leukemia patients, there is little information on cell-based studies. MATERIALS AND METHODS: We established a new human BCR-ABL-positive acute lymphoblastic leukemia (ALL) cell line, SK-9 with the T315I mutation, from the peripheral blood of a 36-year-old female patient. RESULTS: Growth kinetic studies revealed an approximate population doubling time of 48 hours. The common B-cell phenotype is a feature of the SK-9 cell line. Cells have the Philadelphia chromosome (Ph) with many structural abnormalities, as well as the T315I mutation in the BCR-ABL gene. Insertion of SK-9 cells into athymic nude mice induced the formation of tumors in the lymph no","Amino Acid Substitution, Animals, Antineoplastic Agents/pharmacology, Cell Line, Tumor/*enzymology/pathology, Cell Proliferation/drug effects, Disease Models, Animal, Female, Fusion Proteins, bcr-abl/antagonists & inhibitors/genetics/*metabolism, Humans, Lymph Nodes/enzymology/pathol","Okabe S, Tauchi T, Ohyashiki K","Exp Hematol. 2010 Sep;38(9):765-72. doi","2010 Sep","S0301-472X(10)00190-6 [pii], 10.1016/j.exphem.2010.04.017 [doi]","Experimental hematology"
"35","21613408","Insights into ALK-driven cancers revealed through development of nov","Aberrant forms of the anaplastic lymphoma kinase (ALK) have been implicated in the pathogenesis of multiple human cancers, where ALK represents a rational therapeutic target in these settings. In this study, we report the identification and biological characterization of X-376 and X-396, two potent and highly specific ALK small molecule tyrosine kinase inhibitors (TKIs). In Ambit kinome screens, cell growth inhibition studies, and surrogate kinase assays, X-376 and X-396 were more potent inhibitors of ALK but less potent inhibitors of MET compared to PF-02341066 (PF-1066), an ALK/MET dual TKI currently in clinical trials. Both X-376 and X-396 displayed potent antitumor activity in vivo with favorable pharmacokinetic and toxicity profiles. Similar levels of drug sensitivity were displayed by the three most common ALK fusion proteins in lung cancer (EML4-ALK variants E13;A20, E20;A20, and E6b;A20","Anaplastic Lymphoma Kinase, Animals, Brain/metabolism, Cell Line, Tumor, Drug Synergism, Female, Humans, Isoenzymes, Male, Mice, Mice, Inbred C57BL, Mice, Nude, Models, Molecular, Neoplasms/*drug therapy/*enzymology/metabolism, Point Mutation, Protein Kinase Inhibitors/chemistry/phar","Lovly CM, Heuckmann JM, de Stanchina E, Chen H, Thomas RK, Liang C, Pao W","Cancer Res. 2011 Jul 15;71(14):4920-31. doi","2011 Jul","0008-5472.CAN-10-3879 [pii], 10.1158/0008-5472.CAN-10-3879 [doi]","Cancer research"
"36","26755435","Molecular mechanisms that underpin EML4-ALK driven cancers and their","A fusion between the EML4 (echinoderm microtubule-associated protein-like) and ALK (anaplastic lymphoma kinase) genes was identified in non-small cell lung cancer (NSCLC) in 2007 and there has been rapid progress in applying this knowledge to the benefit of patients. However, we have a poor understanding of EML4 and ALK biology and there are many challenges to devising the optimal strategy for treating EML4-ALK NSCLC patients. In this review, we describe the biology of EML4 and ALK, explain the main features of EML4-ALK fusion proteins and outline the therapies that target EML4-ALK. In particular, we highlight the recent advances in our understanding of the structures of EML proteins, describe the molecular mechanisms of resistance to ALK inhibitors and assess current thinking about combinations of ALK drugs with inhibitors that target other kinases or Hsp90.","Anaplastic Lymphoma Kinase, Animals, Carcinoma, Non-Small-Cell Lung/drug therapy/*genetics/metabolism/pathology, Cell Cycle Proteins/analysis/*genetics/metabolism, HSP90 Heat-Shock Proteins/antagonists & inhibitors, Humans, Lung/metabolism/*pathology, Lung Neoplasms/*genetics/metabol","Bayliss R, Choi J, Fennell DA, Fry AM, Richards MW","Cell Mol Life Sci. 2016 Mar;73(6):1209-24. doi","2016 Mar","10.1007/s00018-015-2117-6 [doi], 10.1007/s00018-015-2117-6 [pii]","Cellular and molecular life sciences"
"37","26992917","Elucidation of Resistance Mechanisms to Second-Generation ALK Inhibi","Crizotinib is the first anaplastic lymphoma kinase (ALK) inhibitor to have been approved for the treatment of non-small cell lung cancer (NSCLC) harboring an ALK fusion gene, but it has been found that, in the clinic, patients develop resistance to it. Alectinib and ceritinib are second-generation ALK inhibitors which show remarkable clinical responses in both crizotinib-naive and crizotinib-resistant NSCLC patients harboring an ALK fusion gene. Despite their impressive activity, clinical resistance to alectinib and ceritinib has also emerged. In the current study, we elucidated the resistance mechanisms to these second-generation ALK inhibitors in the H3122 NSCLC cell line harboring the EML4-ALK variant 1 fusion in vitro. Prolonged treatment of the parental H3122 cells with alectinib and ceritinib led to two cell lines which are 10 times less sensitive to alectinib and ceritinib than the paren","Anaplastic Lymphoma Kinase, Carbazoles/administration & dosage, Carcinoma, Non-Small-Cell Lung/*drug therapy/genetics/pathology, Cell Line, Tumor, Drug Resistance, Neoplasm/drug effects/*genetics, ErbB Receptors/antagonists & inhibitors/*biosynthesis, Gene Expression Regulation, Neop","Dong X, Fernandez-Salas E, Li E, Wang S","Neoplasia. 2016 Mar;18(3):162-71. doi","2016 Mar","S1476-5586(16)00021-X [pii], 10.1016/j.neo.2016.02.001 [doi]","Neoplasia (New York, N.Y.)"
"38","25533804","A novel patient-derived tumorgraft model with TRAF1-ALK anaplastic l","Although anaplastic large-cell lymphomas (ALCL) carrying anaplastic lymphoma kinase (ALK) have a relatively good prognosis, aggressive forms exist. We have identified a novel translocation, causing the fusion of the TRAF1 and ALK genes, in one patient who presented with a leukemic ALK+ ALCL (ALCL-11). To uncover the mechanisms leading to high-grade ALCL, we developed a human patient-derived tumorgraft (hPDT) line. Molecular characterization of primary and PDT cells demonstrated the activation of ALK and nuclear factor kB (NFkB) pathways. Genomic studies of ALCL-11 showed the TP53 loss and the in vivo subclonal expansion of lymphoma cells, lacking PRDM1/Blimp1 and carrying c-MYC gene amplification. The treatment with proteasome inhibitors of TRAF1-ALK cells led to the downregulation of p50/p52 and lymphoma growth inhibition. Moreover, a NFkB gene set classifier stratified ALCL in distinct subset","Anaplastic Lymphoma Kinase, Animals, Blotting, Western, *Drug Resistance, Neoplasm, Flow Cytometry, Gene Expression Profiling, High-Throughput Nucleotide Sequencing, Humans, Immunoprecipitation, In Situ Hybridization, Fluorescence, Lymphoma, Large-Cell, Anaplastic/drug therapy/*genet","Abate F, Todaro M, van der Krogt JA, Boi M, Landra I, Machiorlatti R, Tabbo F, Messana K, Abele C, Barreca A, Novero D, Gaudiano M, Aliberti S, Di Giacomo F, Tousseyn T, Lasorsa E, Crescenzo R, Bessone L, Ficarra E, Acquaviva A, Rinaldi A, Ponzoni M, Longo DL, Aime S, Cheng M, Ruggeri B, Piccaluga PP, Pile","Leukemia. 2015 Jun;29(6):1390-401. doi","2015 Jun","leu2014347 [pii], 10.1038/leu.2014.347 [doi]","Leukemia"
"39","10071078","Establishment of a double Philadelphia chromosome-positive acute lym","A double Philadelphia chromosome (Ph)-positive leukemia cell line with common-B cell phenotype, designated TMD5, was established from the blast cells of a patient with double Ph-positive acute lymphoblastic leukemia. TMD5 cells expressed 190 kDa BCR/ABL chimeric protein and 145 kDa ABL protein. The cells proliferated without added growth factors. Autocrine growth mechanism was not recognized. The addition of growth factors such as G-CSF, GM-CSF, IL-3, IL-6, or Stem Cell Factor did not affect the growth. Herbimycin A suppressed the growth of TMD5 cells at the low concentration that did not affect Ph-negative cells. It suppressed tyrosine phosphorylation of intracellular proteins in TMD5 cells. Dexamethasone and dibutyryl cyclic AMP also suppressed the growth. They, however, did not affect the phosphorylation significantly. Neither all-trans retinoic acid nor interferon-alpha affected the growth.","Adult, Bucladesine/pharmacology, Calcium-Calmodulin-Dependent Protein Kinases/physiology, Cell Differentiation/drug effects, Cell Division/drug effects, Cytokines/*pharmacology, Humans, Male, *Philadelphia Chromosome, Phosphorylation, Precursor Cell Lymphoblastic Leukemia-Lymphoma/*g","Tohda S, Sakashita C, Fukuda T, Murakami N, Nara N","Leuk Res. 1999 Mar;23(3):255-61. doi","1999 Mar","S0145-2126(98)00172-6 [pii], 10.1016/s0145-2126(98)00172-6 [doi]","Leukemia research"
"40","23443800","ALK inhibitor PF02341066 (crizotinib) increases sensitivity to radia","Crizotinib (PF02341066) is a tyrosine kinase inhibitor of anaplastic lymphoma kinase (ALK) that has been shown to selectively inhibit growth of cancer cells that harbor the EML4-ALK fusion found in a subset of patients with non-small cell lung cancer (NSCLC). While in clinical trials, PF02341066 has shown a significant therapeutic benefit as a single agent; the effectiveness of combining it with other therapeutic modalities including ionizing radiation remains unknown. To further elucidate the role of PF02341066 in tumor inhibition, we examined its effects alone and in combination with radiation on downstream signaling, apoptosis, and radiosensitivity in two NSCLC cell lines in vitro: H3122, which harbors the EML4-ALK fusion, and H460, which does not. We also examined the in vivo effects of PF02341066 in H3122 mouse xenografts. In the H3122 cell line, PF02341066 inhibited phosphorylation of ALK","Anaplastic Lymphoma Kinase, Animals, Apoptosis/drug effects/radiation effects, Carcinoma, Non-Small-Cell Lung/*genetics/metabolism/pathology, Cell Line, Tumor, Cell Proliferation/drug effects/radiation effects, Crizotinib, Dose-Response Relationship, Drug, Female, Gene Expression Reg","Sun Y, Nowak KA, Zaorsky NG, Winchester CL, Dalal K, Giacalone NJ, Liu N, Werner-Wasik M, Wasik MA, Dicker AP, Lu B","Mol Cancer Ther. 2013 May;12(5):696-704. doi","2013 May","1535-7163.MCT-12-0868 [pii], 10.1158/1535-7163.MCT-12-0868 [doi]","Molecular cancer therapeutics"
"41","25193384","ALK-dependent control of hypoxia-inducible factors mediates tumor gr","Rearrangements involving the anaplastic lymphoma kinase (ALK) gene are defining events in several tumors, including anaplastic large-cell lymphoma (ALCL) and non-small cell lung carcinoma (NSCLC). In such cancers, the oncogenic activity of ALK stimulates signaling pathways that induce cell transformation and promote tumor growth. In search for common pathways activated by oncogenic ALK across different tumors types, we found that hypoxia pathways were significantly enriched in ALK-rearranged ALCL and NSCLC, as compared with other types of T-cell lymphoma or EGFR- and K-RAS-mutated NSCLC, respectively. Consistently, in both ALCL and NSCLC, we found that under hypoxic conditions, ALK directly regulated the abundance of hypoxia-inducible factors (HIF), which are key players of the hypoxia response in normal tissues and cancers. In ALCL, the upregulation of HIF1alpha and HIF2alpha in hypoxic condit","Anaplastic Lymphoma Kinase, Animals, Basic Helix-Loop-Helix Transcription Factors/biosynthesis, Carcinoma, Non-Small-Cell Lung/*genetics/pathology, Cell Line, Tumor, Cell Proliferation/*genetics, ErbB Receptors/biosynthesis/genetics, Gene Expression Regulation, Neoplastic/genetics, H","Martinengo C, Poggio T, Menotti M, Scalzo MS, Mastini C, Ambrogio C, Pellegrino E, Riera L, Piva R, Ribatti D, Pastorino F, Perri P, Ponzoni M, Wang Q, Voena C, Chiarle R","Cancer Res. 2014 Nov 1;74(21):6094-106. doi","2014 Nov","0008-5472.CAN-14-0268 [pii], 10.1158/0008-5472.CAN-14-0268 [doi]","Cancer research"
"42","28370702","Effects of SMYD2-mediated EML4-ALK methylation on the signaling path","A specific subtype of non-small-cell lung cancer (NSCLC) characterized with an EML4-ALK fusion gene, which drives constitutive oncogenic activation of anaplastic lymphoma kinase (ALK), shows a good clinical response to ALK inhibitors. We have reported multiple examples implying the biological significance of methylation on non-histone proteins including oncogenic kinases in human carcinogenesis. Through the process to search substrates for various methyltransferases using an in vitro methyltransferase assay, we found that a lysine methyltransferase, SET and MYND domain-containing 2 (SMYD2), could methylate lysine residues 1451, 1455, and 1610 in ALK protein. Knockdown of SMYD2 as well as treatment with a SMYD2 inhibitor in two NSCLC cell lines with an EML4-ALK gene significantly attenuated the phosphorylation levels of the EML4-ALK protein. Substitutions of each of these three lysine residues t","Anaplastic Lymphoma Kinase, Apoptosis/genetics, Carcinoma, Non-Small-Cell Lung/*genetics/pathology, Cell Line, Tumor, Cell Proliferation/*genetics, Histone-Lysine N-Methyltransferase/*genetics, Humans, Lung Neoplasms/*genetics/pathology, Methylation, Oncogene Proteins, Fusion/*geneti","Wang R, Deng X, Yoshioka Y, Vougiouklakis T, Park JH, Suzuki T, Dohmae N, Ueda K, Hamamoto R, Nakamura Y","Cancer Sci. 2017 Jun;108(6):1203-1209. doi","2017 Jun","10.1111/cas.13245 [doi]","Cancer science"
"43","27811184","Coupling an EML4-ALK-centric interactome with RNA interference ident","Patients with lung cancers harboring anaplastic lymphoma kinase (ALK) gene fusions benefit from treatment with ALK inhibitors, but acquired resistance inevitably arises. A better understanding of proximal ALK signaling mechanisms may identify sensitizers to ALK inhibitors that disrupt the balance between prosurvival and proapoptotic effector signals. Using affinity purification coupled with mass spectrometry in an ALK fusion lung cancer cell line (H3122), we generated an ALK signaling network and investigated signaling activity using tyrosine phosphoproteomics. We identified a network of 464 proteins composed of subnetworks with differential response to ALK inhibitors. A small hairpin RNA screen targeting 407 proteins in this network revealed 64 and 9 proteins that when knocked down sensitized cells to crizotinib and alectinib, respectively. Among these, knocking down fibroblast growth factor r","Adaptor Proteins, Signal Transducing/genetics/metabolism, Anaplastic Lymphoma Kinase, Carbazoles/*pharmacology, *Cell Cycle Proteins/genetics/metabolism, Cell Line, Tumor, Crizotinib, DNA-Binding Proteins/genetics/metabolism, Humans, *Lung Neoplasms/drug therapy/genetics/metabolism, ","Zhang G, Scarborough H, Kim J, Rozhok AI, Chen YA, Zhang X, Song L, Bai Y, Fang B, Liu RZ, Koomen J, Tan AC, Degregori J, Haura EB","Sci Signal. 2016 Oct 18;9(450):rs12. doi","2016 Oct","9/450/rs12 [pii], 10.1126/scisignal.aaf5011 [doi]","Science signaling"
"44","27780853","The Potent ALK Inhibitor Brigatinib (AP26113) Overcomes Mechanisms o","PURPOSE: Non-small cell lung cancers (NSCLCs) harboring ALK gene rearrangements (ALK(+)) typically become resistant to the first-generation anaplastic lymphoma kinase (ALK) tyrosine kinase inhibitor (TKI) crizotinib through development of secondary resistance mutations in ALK or disease progression in the brain. Mutations that confer resistance to second-generation ALK TKIs ceritinib and alectinib have also been identified. Here, we report the structure and first comprehensive preclinical evaluation of the next-generation ALK TKI brigatinib. EXPERIMENTAL DESIGN: A kinase screen was performed to evaluate the selectivity profile of brigatinib. The cellular and in vivo activities of ALK TKIs were compared using engineered and cancer-derived cell lines. The brigatinib-ALK co-structure was determined. RESULTS: Brigatinib potently inhibits ALK and ROS1, with a high degree of selectivity over more tha","Anaplastic Lymphoma Kinase, Antineoplastic Agents/*pharmacology, Carcinoma, Non-Small-Cell Lung/*drug therapy/metabolism, Cell Line, Tumor, Crizotinib, Drug Resistance, Neoplasm/*drug effects, Hep G2 Cells, Humans, Lung Neoplasms/*drug therapy/metabolism, Mutation/drug effects, Organ","Zhang S, Anjum R, Squillace R, Nadworny S, Zhou T, Keats J, Ning Y, Wardwell SD, Miller D, Song Y, Eichinger L, Moran L, Huang WS, Liu S, Zou D, Wang Y, Mohemmad Q, Jang HG, Ye E, Narasimhan N, Wang F, Miret J, Zhu X, Clackson T, Dalgarno D, Shakespeare WC, Rivera VM","Clin Cancer Res. 2016 Nov 15;22(22):5527-5538. doi","2016 Nov","1078-0432.CCR-16-0569 [pii], 10.1158/1078-0432.CCR-16-0569 [doi]","Clinical cancer research"
"45","15610007","Efficient silencing of bcr/abl oncogene by single- and double-strand","In this work, double- and single-stranded small-interference RNAs (siRNAs) were designed to knock down the bcr/abl oncogene in leukaemia KYO-1 cells. The siRNA molecules were targeted against two distinct sites encompassing the b2a2 junction of the bcr/abl transcripts. The siRNAs were able to reduce the levels of both bcr/abl mRNA and protein p210(BCR/ABL). Conversely, control siRNAs bearing 3 or 4 base-pair substitutions did not produce any inhibitory effect. The designed siRNAs were also found to be active in KCl22 cells, which harbor the b2a2 junction, but not in K562 cells, which, by contrast, harbor the b3a2 junction. The anti-b2a2 siRNAs promoted biological effects on KYO-1 cells, because the bcr/abl suppression resulted in the inhibition of cell growth and colony formation in agar and activation of apoptosis and upregulation of the cell-cycle inhibitor p27 protein. The bioactivity of the","Base Sequence, Blotting, Western, Electroporation, Flow Cytometry, Fusion Proteins, bcr-abl/*genetics/metabolism, Gene Silencing/*physiology, Genes, abl/*physiology, Immunoblotting, Molecular Sequence Data, RNA, Messenger/metabolism, RNA, Small Interfering/*metabolism, Reverse Transc","Rapozzi V, Xodo LE","Biochemistry. 2004 Dec 28;43(51):16134-41. doi","2004 Dec","10.1021/bi048634w [doi]","Biochemistry"
"46","26421285","Effects of a Particular Heptapeptide on the IFN-alpha-Sensitive CML ","Using the phage display biopanning technique, we have previously identified a heptapeptide KLWVIPQ which specifically binds to the surface of the IFN-alpha-sensitive but not the IFN-alpha-resistant CML cells. The effects of this heptapeptide on the IFN-alpha-sensitive CML cells were investigated in the present study. IFN-alpha-sensitive KT-1/A3 and IFN-alpha-resistant KT-1/A3R CML cells were transfected by pEGFP-KLWVIPQ expression vector and/or induced by IFN-alpha. WST-1 cell proliferation assay, flow cytometry, and western blotting were performed to determine the effects of this heptapeptide and/or IFN-alpha on CML cells. The viability of the KT-1/A3 cells was inhibited and apoptosis was induced by either expression of the heptapeptide KLWVIPQ or IFN-alpha treatment with concurrent upregulation of P53 and downregulation of P210(bcr/abl). However, these effects were not observed in the IFN-alp","Amino Acid Sequence, Cell Line, Tumor, Cell Survival/drug effects, Gene Expression Regulation, Leukemic/drug effects, Genetic Vectors/metabolism, Green Fluorescent Proteins/metabolism, Humans, Interferon-alpha/*pharmacology, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics/*","Yang FL, Chen FZ, Wan XX, Zhou X, Zhou MJ, Chen HC, Fu JJ, Zhang DZ","Biomed Res Int. 2015;2015:325026. doi","2015","10.1155/2015/325026 [doi]","BioMed research international"
"47","9874796","The BCR-ABL oncoprotein potentially interacts with the xeroderma pig","The previously uncharacterized CDC24 homology domain of BCR, which is missing in the P185 BCR-ABL oncogene of Philadelphia chromosome (Ph1)-positive acute lymphocytic leukemia but is retained in P210 BCR-ABL of chronic myelogeneous leukemia, was found to bind to the xeroderma pigmentosum group B protein (XPB). The binding appeared to be required for XPB to be tyrosine-phosphorylated by BCR-ABL. The interaction not only reduced both the ATPase and the helicase activities of XPB purified in the baculovirus system but also impaired XPB-mediated cross-complementation of the repair deficiency in rodent UV-sensitive mutants of group 3. The persistent dysfunction of XPB may in part underlie genomic instability in blastic crisis.","Adenosine Triphosphatases/analysis, Animals, Blast Crisis/*etiology, CHO Cells, Cell Cycle Proteins/*metabolism, Cricetinae, DNA Helicases/analysis, DNA-Binding Proteins/*metabolism, Dose-Response Relationship, Radiation, Fusion Proteins, bcr-abl/*metabolism, *Guanine Nucleotide Exch","Takeda N, Shibuya M, Maru Y","Proc Natl Acad Sci U S A. 1999 Jan 5;96(1):203-7. doi","1999 Jan","10.1073/pnas.96.1.203 [doi]","Proceedings of the National Academy of Sciences of the United States of America"
"48","31222839","Identification of candidates for driver oncogenes in scirrhous-type ","Scirrhous-type gastric cancer (SGC) is one of the most intractable cancer subtypes in humans, and its therapeutic targets have been rarely identified to date. Exploration of somatic mutations in the SGC genome with the next-generation sequencers has been hampered by markedly increased fibrous tissues. Thus, SGC cell lines may be useful resources for searching for novel oncogenes. Here we have conducted whole exome sequencing and RNA sequencing on 2 SGC cell lines, OCUM-8 and OCUM-9. Interestingly, most of the mutations thus identified have not been reported. In OCUM-8 cells, a novel CD44-IGF1R fusion gene is discovered, the protein product of which ligates the amino-terminus of CD44 to the transmembrane and tyrosine-kinase domains of IGF1R. Furthermore, both CD44 and IGF1R are markedly amplified in the OCUM-8 genome and abundantly expressed. CD44-IGF1R has a transforming ability, and the suppre","3T3 Cells, Adenocarcinoma, Scirrhous/*genetics/pathology, Animals, Cell Line, Cell Line, Tumor, Cell Proliferation/genetics, HEK293 Cells, Humans, Hyaluronan Receptors/genetics, Membrane Proteins/genetics, Mice, Mutation/genetics, Oncogenes/*genetics, Receptor, IGF Type 1/genetics, S","Sai E, Miwa Y, Takeyama R, Kojima S, Ueno T, Yashiro M, Seto Y, Mano H","Cancer Sci. 2019 Aug;110(8):2643-2651. doi","2019 Aug","10.1111/cas.14111 [doi]","Cancer science"
"49","28740365","Spotlight on ceritinib in the treatment of ALK+ NSCLC","The identification of echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) fusion gene in non-small cell lung cancer (NSCLC) has radically changed the treatment of a subset of patients harboring this oncogenic driver. Crizotinib was the first ALK tyrosine kinase inhibitor to receive fast approval and is currently indicated as the first-line therapy for advanced, ALK-positive NSCLC patients. However, despite crizotinib's efficacy, patients almost invariably progress, with the central nervous system being one of the most common sites of relapse. Different mechanisms of acquired resistance have been identified, including secondary ALK mutations, ALK copy number alterations and activation of bypass tracks. Different highly potent and brain-penetrant next-generation ALK inhibitors have been developed and tested in NSCLC patients with ALK rearrangements. Ceriti","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/adverse effects/*therapeutic use, Carcinoma, Non-Small-Cell Lung/*drug therapy, Clinical Trials, Phase I as Topic, Clinical Trials, Phase II as Topic, Clinical Trials, Phase III as Topic, Drug Resistance, Neoplasm/drug effect","Santarpia M, Daffina MG', ""D'Aveni A"", 'Marabello G, Liguori A, Giovannetti E, Karachaliou N, Gonzalez Cao M, Rosell R, Altavilla G","Drug Des Devel Ther. 2017 Jul 5;11:2047-2063. doi","2017","10.2147/DDDT.S113500 [doi], dddt-11-2047 [pii]","Drug design, development and therapy"
"50","24691473","Translational regulation of GPx-1 and GPx-4 by the mTOR pathway.","Glutathione peroxidase activity was previously determined to be elevated in lymphocytes obtained from patients treated with the Bcr-Abl kinase inhibitor imatinib mesylate. In order to expand upon this observation, the established chronic myelogenous leukemia cell lines KU812 and MEG-01 were treated with imatinib and the effect on several anti-oxidant proteins was determined. The levels of GPx-1 were significantly increased following treatment with imatinib. This increase was not due to altered steady-state mRNA levels, and appeared to be dependent on the expression of Bcr-Abl, as no increases were observed following imatinib treatment of cells that did not express the fusion protein. The nutrient-sensing signaling protein, mammalian target of rapamycin (mTOR), can be activated by Bcr-Abl and its activity regulates the translation of many different proteins. Treatment of those same cells used in","Antineoplastic Agents/pharmacology, Antioxidants/metabolism, Cell Line, Tumor, Enzyme Activation/drug effects, Fusion Proteins, bcr-abl/genetics/metabolism, *Gene Expression Regulation/drug effects, Glutathione Peroxidase/*genetics/metabolism, Humans, Imatinib Mesylate/pharmacology, ","Reinke EN, Ekoue DN, Bera S, Mahmud N, Diamond AM","PLoS One. 2014 Apr 1;9(4):e93472. doi","2014","10.1371/journal.pone.0093472 [doi], PONE-D-14-06318 [pii]","PloS one"
"51","24675041","The ALK inhibitor ceritinib overcomes crizotinib resistance in non-s","UNLABELLED: Non-small cell lung cancers (NSCLC) harboring anaplastic lymphoma kinase (ALK) gene rearrangements invariably develop resistance to the ALK tyrosine kinase inhibitor (TKI) crizotinib. Herein, we report the first preclinical evaluation of the next-generation ALK TKI, ceritinib (LDK378), in the setting of crizotinib resistance. An interrogation of in vitro and in vivo models of acquired resistance to crizotinib, including cell lines established from biopsies of patients with crizotinib-resistant NSCLC, revealed that ceritinib potently overcomes crizotinib-resistant mutations. In particular, ceritinib effectively inhibits ALK harboring L1196M, G1269A, I1171T, and S1206Y mutations, and a cocrystal structure of ceritinib bound to ALK provides structural bases for this increased potency. However, we observed that ceritinib did not overcome two crizotinib-resistant ALK mutations, G1202R an","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/*therapeutic use, Carcinoma, Non-Small-Cell Lung/*drug therapy/genetics/metabolism/pathology, Cell Line, Tumor, Crizotinib, Drug Resistance, Neoplasm/drug effects/genetics, Humans, Lung Neoplasms/*drug therapy/genetics/metabo","Friboulet L, Li N, Katayama R, Lee CC, Gainor JF, Crystal AS, Michellys PY, Awad MM, Yanagitani N, Kim S, Pferdekamper AC, Li J, Kasibhatla S, Sun F, Sun X, Hua S, McNamara P, Mahmood S, Lockerman EL, Fujita N, Nishio M, Harris JL, Shaw AT, Engelman JA","Cancer Discov. 2014 Jun;4(6):662-673. doi","2014 Jun","10.1158/2159-8290.CD-13-0846 [doi]","Cancer discovery"
"52","31097696","Functional linkage of gene fusions to cancer cell fitness assessed b","Many gene fusions are reported in tumours and for most their role remains unknown. As fusions are used for diagnostic and prognostic purposes, and are targets for treatment, it is crucial to assess their function in cancer. To systematically investigate the role of fusions in tumour cell fitness, we utilized RNA-sequencing data from 1011 human cancer cell lines to functionally link 8354 fusion events with genomic data, sensitivity to >350 anti-cancer drugs and CRISPR-Cas9 loss-of-fitness effects. Established clinically-relevant fusions were identified. Overall, detection of functional fusions was rare, including those involving cancer driver genes, suggesting that many fusions are dispensable for tumour fitness. Therapeutically actionable fusions involving RAF1, BRD4 and ROS1 were verified in new histologies. In addition, recurrent YAP1-MAML2 fusions were identified as activators of Hippo-pathw","Antineoplastic Agents/pharmacology, Biomarkers, Tumor/*genetics, CRISPR-Cas Systems/*genetics, Carcinogenesis/genetics, Cell Line, Tumor, Datasets as Topic, Drug Resistance, Neoplasm/genetics, Early Detection of Cancer/methods, Gene Expression Profiling/methods, Gene Expression Regul","Picco G, Chen ED, Alonso LG, Behan FM, Goncalves E, Bignell G, Matchan A, Fu B, Banerjee R, Anderson E, Butler A, Benes CH, McDermott U, Dow D, Iorio F, Stronach E, Yang F, Yusa K, Saez-Rodriguez J, Garnett MJ","Nat Commun. 2019 May 16;10(1):2198. doi","2019 May","10.1038/s41467-019-09940-1 [doi], 10.1038/s41467-019-09940-1 [pii]","Nature communications"
"53","10910048","BCR-ABL mediates arsenic trioxide-induced apoptosis independently of","In the prechemotherapy era arsenic derivatives were used for treatment of chronic myelogenous leukemia, a myeloproliferative disorder characterized by the t(9;22) translocation, the Philadelphia chromosome (Ph+). In acute promyelocytic leukemia response to arsenic trioxide (As2O3) has been shown to be genetically determined by the acute promyelocytic leukemia-specific t(15;17) translocation product PML/RARalpha. Hence, we reasoned that As2O3 might have a selective inhibitory effect on proliferation of BCR-ABL-expressing cells. Here, we report that: (a) As2O3 induced apoptosis in Ph+ but not in Ph- lymphoblasts; (b) enforced expression of BCR-ABL in U937 cells dramatically increased the sensitivity to As2O3; (c) the effect of As2O3 was independent of BCR-ABL kinase activity; and (d) As2O3 reduced proliferation of chronic myelogenous leukemia blasts but not of peripheral CD34+ progenitors. In sum","Antigens, CD34/analysis, Antineoplastic Agents/*pharmacology, Apoptosis/drug effects/*physiology, Arsenic Trioxide, Arsenicals/*pharmacology, Blast Crisis/pathology, Cells, Cultured, Colony-Forming Units Assay, Fusion Proteins, bcr-abl/genetics/*metabolism, Hematopoietic Stem Cells/d","Puccetti E, Guller S, Orleth A, Bruggenolte N, Hoelzer D, Ottmann OG, Ruthardt M","Cancer Res. 2000 Jul 1;60(13):3409-13.","2000 Jul","?","Cancer research"
"54","28990077","Inhibitory effect of the anthelmintic drug pyrvinium pamoate on T315","Chronic myeloid leukemia (CML) is a clonal myeloproliferative disorder characterized by a chromosome translocation that generates the BCRABL oncogene, which encodes a constitutively activated tyrosine kinase. Despite progress in controlling CML at the chronic phase by first and second generations of BCRABL tyrosine kinase inhibitors (TKIs), effective drugs with good safety are not available for CML patients harboring T315I BCRABL and those in advanced stages of CML. Therefore, there is an urgent requirement for the development of effective therapies against T315I BCRABL. In the present study, it was demonstrated that pyrvinium pamoate, an anthelmintic drug approved by the Food and Drug Administration had potent inhibitory effects on growth and survival in CML cells with T315I BCRABL. In addition, this agent was equally effective in inhibiting the Wnt/betacatenin signaling in wildtype and T315I ","*Alleles, *Amino Acid Substitution, Anthelmintics/*pharmacology, Antineoplastic Agents/*pharmacology, Apoptosis/drug effects, Cell Line, Tumor, Fusion Proteins, bcr-abl/*genetics, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/drug therapy/*genetics, *Mutation, ","Zhang J, Jin Y, Pan J","Mol Med Rep. 2017 Dec;16(6):9217-9223. doi","2017 Dec","10.3892/mmr.2017.7685 [doi]","Molecular medicine reports"
"55","26018086","Evidence Suggesting That Discontinuous Dosing of ALK Kinase Inhibito","The anaplastic lymphoma kinase (ALK) is chromosomally rearranged in a subset of certain cancers, including 2% to 7% of non-small cell lung cancers (NSCLC) and approximately 70% of anaplastic large cell lymphomas (ALCL). The ALK kinase inhibitors crizotinib and ceritinib are approved for relapsed ALK(+) NSCLC, but acquired resistance to these drugs limits median progression-free survival on average to approximately 10 months. Kinase domain mutations are detectable in 25% to 37% of resistant NSCLC samples, with activation of bypass signaling pathways detected frequently with or without concurrent ALK mutations. Here we report that, in contrast to NSCLC cells, drug-resistant ALCL cells show no evidence of bypassing ALK by activating alternate signaling pathways. Instead, drug resistance selected in this setting reflects upregulation of ALK itself. Notably, in the absence of crizotinib or ceritinib","Anaplastic Lymphoma Kinase, Animals, Carcinoma, Non-Small-Cell Lung/*drug therapy/genetics/metabolism, Cell Line, Tumor, Crizotinib, Drug Administration Schedule, Humans, Lung Neoplasms/*drug therapy/genetics/metabolism, Lymphoma, Large-Cell, Anaplastic/*drug therapy/genetics/metabol","Amin AD, Rajan SS, Liang WS, Pongtornpipat P, Groysman MJ, Tapia EO, Peters TL, Cuyugan L, Adkins J, Rimsza LM, Lussier YA, Puvvada SD, Schatz JH","Cancer Res. 2015 Jul 15;75(14):2916-27. doi","2015 Jul","0008-5472.CAN-14-3437 [pii], 10.1158/0008-5472.CAN-14-3437 [doi]","Cancer research"
"56","19887607","NPM-ALK oncogenic tyrosine kinase controls T-cell identity by transc","Transformed cells in lymphomas usually maintain the phenotype of the postulated normal lymphocyte from which they arise. By contrast, anaplastic large cell lymphoma (ALCL) is a T-cell lymphoma with aberrant phenotype because of the defective expression of the T-cell receptor and other T-cell-specific molecules for still undetermined mechanisms. The majority of ALCL carries the translocation t(2;5) that encodes for the oncogenic tyrosine kinase NPM-ALK, fundamental for survival, proliferation, and migration of transformed T cells. Here, we show that loss of T-cell-specific molecules in ALCL cases is broader than reported previously and involves most T-cell receptor-related signaling molecules, including CD3epsilon, ZAP70, LAT, and SLP76. We further show that NPM-ALK, but not the kinase-dead NPM-ALK(K210R), downregulated the expression of these molecules by a STAT3-mediated gene transcription reg","Adaptor Proteins, Signal Transducing/biosynthesis, Animals, CD3 Complex/biosynthesis, DNA (Cytosine-5-)-Methyltransferase 1, DNA (Cytosine-5-)-Methyltransferases/metabolism, *Gene Expression Regulation, Neoplastic, Gene Silencing/*physiology, Humans, Immunoblotting, Immunohistochemis","Ambrogio C, Martinengo C, Voena C, Tondat F, Riera L, di Celle PF, Inghirami G, Chiarle R","Cancer Res. 2009 Nov 15;69(22):8611-9. doi","2009 Nov","0008-5472.CAN-09-2655 [pii], 10.1158/0008-5472.CAN-09-2655 [doi]","Cancer research"
"57","26179066","BCR/ABL1 and BCR are under the transcriptional control of the MYC on","BACKGROUND: Chronic Myeloid Leukaemia (CML) is caused by the BCR/ABL1 fusion gene. Both the presence and the levels of BCR/ABL1 expression seem to be critical for CML progression from chronic phase (CP) to blast crisis (BC). After the oncogenic translocation, the BCR/ABL1 gene is under the transcriptional control of BCR promoter but the molecular mechanisms involved in the regulation of oncogene expression are mostly unknown. METHODS: A region of 1443bp of the functional BCR promoter was studied for transcription factor binding sites through in-silico analysis and Chromatin Immunoprecipitation experiments. BCR and BCR/ABL1 expression levels were analysed in CML cell lines after over-expression or silencing of MYC transcription factor. A luciferase reporter assay was used to confirm its activity on BCR promoter. RESULTS: In the present study we demonstrate that MYC and its partner MAX bind to th","Base Sequence, Basic Helix-Loop-Helix Leucine Zipper Transcription Factors/genetics/metabolism, Binding Sites, Cell Line, Tumor, Fusion Proteins, bcr-abl/*genetics, *Gene Expression Regulation, Leukemic, Gene Silencing, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetic","Sharma N, Magistroni V, Piazza R, Citterio S, Mezzatesta C, Khandelwal P, Pirola A, Gambacorti-Passerini C","Mol Cancer. 2015 Jul 16;14:132. doi","2015 Jul","10.1186/s12943-015-0407-0 [doi], 10.1186/s12943-015-0407-0 [pii]","Molecular cancer"
"58","27707887","Overcoming EGFR Bypass Signal-Induced Acquired Resistance to ALK Tyr","Activation of the EGFR pathway is one of the mechanisms inducing acquired resistance to anaplastic lymphoma kinase (ALK) tyrosine kinase inhibitors (TKI) such as crizotinib and alectinib. Ceritinib is a highly selective ALK inhibitor and shows promising efficacy in non-small cell lung cancers (NSCLC) harboring the ALK gene rearrangement. However, the precise mechanism underlying acquired resistance to ceritinib is not well-defined. This study set out to clarify the mechanism in ALK-translocated lung cancer and to find the preclinical rationale overcoming EGFR pathway-induced acquired resistance to ALK-TKIs. To this end, ceritinib-resistant cells (H3122-CER) were established from the H3122 NSCLC cell line harboring the ALK gene rearrangement via long-term exposure to ceritinib. H3122-CER cells acquired resistance to ceritinib through EGFR bypass pathway activation. Furthermore, H3122 cells that ","Afatinib, Anaplastic Lymphoma Kinase, Antineoplastic Combined Chemotherapy Protocols/pharmacology/therapeutic use, Cell Line, Tumor, Drug Resistance, Neoplasm/*drug effects, ErbB Receptors/*metabolism, Humans, Ligands, Lung Neoplasms/drug therapy/enzymology/*pathology, Phosphorylatio","Miyawaki M, Yasuda H, Tani T, Hamamoto J, Arai D, Ishioka K, Ohgino K, Nukaga S, Hirano T, Kawada I, Naoki K, Hayashi Y, Betsuyaku T, Soejima K","Mol Cancer Res. 2017 Jan;15(1):106-114. doi","2017 Jan","1541-7786.MCR-16-0211 [pii], 10.1158/1541-7786.MCR-16-0211 [doi]","Molecular cancer research"
"59","24162815","Oncogenic and drug-sensitive NTRK1 rearrangements in lung cancer.","We identified new gene fusions in patients with lung cancer harboring the kinase domain of the NTRK1 gene that encodes the high-affinity nerve growth factor receptor (TRKA protein). Both the MPRIP-NTRK1 and CD74-NTRK1 fusions lead to constitutive TRKA kinase activity and are oncogenic. Treatment of cells expressing NTRK1 fusions with inhibitors of TRKA kinase activity inhibited autophosphorylation of TRKA and cell growth. Tumor samples from 3 of 91 patients with lung cancer (3.3%) without known oncogenic alterations assayed by next-generation sequencing or fluorescence in situ hybridization demonstrated evidence of NTRK1 gene fusions.","Adaptor Proteins, Signal Transducing/genetics, Antigens, Differentiation, B-Lymphocyte/genetics, Cell Line, Tumor, *Gene Rearrangement, Histocompatibility Antigens Class II/genetics, Humans, In Situ Hybridization, Fluorescence, Lung Neoplasms/*drug therapy/*genetics, Molecular Sequen","Vaishnavi A, Capelletti M, Le AT, Kako S, Butaney M, Ercan D, Mahale S, Davies KD, Aisner DL, Pilling AB, Berge EM, Kim J, Sasaki H, Park S, Kryukov G, Garraway LA, Hammerman PS, Haas J, Andrews SW, Lipson D, Stephens PJ, Miller VA, Varella-Garcia M, Janne PA, Doebele RC","Nat Med. 2013 Nov;19(11):1469-1472. doi","2013 Nov","10.1038/nm.3352 [doi]","Nature medicine"
"60","24012109","Aberrant signalling by protein kinase CK2 in imatinib-resistant chro","Chronic myeloid leukaemia (CML) is driven by the fusion protein Bcr-Abl, a constitutively active tyrosine kinase playing a crucial role in initiation and maintenance of CML phenotype. Despite the great efficacy of the Bcr-Abl-specific inhibitor imatinib, resistance to this drug is recognized as a major problem in CML treatment. We found that in LAMA84 cells, characterized by imatinib-resistance caused by BCR-ABL1 gene amplification, the pro-survival protein kinase CK2 is up-regulated as compared to the sensitive cells. CK2 exhibits a higher protein-level and a parallel enhancement of catalytic activity. Consistently, CK2-catalysed phosphorylation of Akt-Ser129 is increased. CK2 co-localizes with Bcr-Abl in the cytoplasmic fraction as judged by subcellular fractionation and fluorescence immunolocalization. CK2 and Bcr-Abl are members of the same multi-protein complex(es) in imatinib-resistant ce","Antineoplastic Agents/*pharmacology, Apoptosis/drug effects/genetics, Benzamides/*pharmacology, Casein Kinase II/antagonists & inhibitors/genetics/*metabolism, Drug Resistance, Neoplasm/*drug effects/genetics, Fusion Proteins, bcr-abl/antagonists & inhibitors/genetics/metabolism, Gen","Borgo C, Cesaro L, Salizzato V, Ruzzene M, Massimino ML, Pinna LA, Donella-Deana A","Mol Oncol. 2013 Dec;7(6):1103-15. doi","2013 Dec","S1574-7891(13)00117-8 [pii], 10.1016/j.molonc.2013.08.006 [doi]","Molecular oncology"
"61","23856031","Antitumor activities of the targeted multi-tyrosine kinase inhibitor","RET gene fusions are recurrent oncogenes identified in thyroid and lung carcinomas. Lenvatinib is a multi-tyrosine kinase inhibitor currently under evaluation in several clinical trials. Here we evaluated lenvatinib in RET gene fusion-driven preclinical models. In cellular assays, lenvatinib inhibited auto-phosphorylation of KIF5B-RET, CCDC6-RET, and NcoA4-RET. Lenvatinib suppressed the growth of CCDC6-RET human thyroid and lung cancer cell lines, and as well, suppressed anchorage-independent growth and tumorigenicity of RET gene fusion-transformed NIH3T3 cells. These results demonstrate that lenvatinib can exert antitumor activity against RET gene fusion-driven tumor models by inhibiting oncogenic RET gene fusion signaling.","Animals, Antineoplastic Agents/*pharmacology, Cell Line, Tumor, Cell Transformation, Neoplastic/drug effects/genetics, Cytoskeletal Proteins/genetics/metabolism, Drug Screening Assays, Antitumor, Female, Humans, Mice, Mice, Inbred BALB C, Mice, Nude, NIH 3T3 Cells, Neoplasm Transplan","Okamoto K, Kodama K, Takase K, Sugi NH, Yamamoto Y, Iwata M, Tsuruoka A","Cancer Lett. 2013 Oct 28;340(1):97-103. doi","2013 Oct","S0304-3835(13)00512-0 [pii], 10.1016/j.canlet.2013.07.007 [doi]","Cancer letters"
"62","7787756","Establishment and characterization of a new Ph1-positive chronic mye","A new Ph1-positive leukemic cell line (MC3) expressing the P210bcr/abl oncoprotein was established from a patient with CML in blast crisis. The MC3 cells showed the trilineage phenotype of myeloid, lymphoid (CD19) and megakaryocytoid lineages, and had a proliferative response to rhIL-1 and rhIL-3 in the serum-free culture. These results and the expression of CD34 indicated that the MC3 cells have characteristics of hematopoietic progenitor cells. Recently, it has been documented that alterations of the p53 gene in leukemic cells are frequently detected during the blast crisis of CML. The MC3 cells contained the altered p53 gene. In addition, the original leukemic cells showed the point-mutational activation of the N-ras gene and an additional chromosomal abnormality inv(3q), but the MC3 cells contained no such abnormalities, indicating that not all of the original leukemic cells had these abnor","3T3 Cells, Animals, Base Sequence, Biomarkers, Blast Crisis/genetics/*pathology, Cell Division/drug effects, Culture Media, Serum-Free, DNA, Neoplasm/genetics, Fatal Outcome, Female, Fusion Proteins, bcr-abl/analysis, Genes, abl, *Genes, p53, Genes, ras, Humans, Immunophenotyping, In","Okabe M, Kunieda Y, Nakane S, Kurosawa M, Itaya T, Vogler WR, Shoji M, Miyazaki T","Leuk Lymphoma. 1995 Feb;16(5-6):493-503. doi","1995 Feb","10.3109/10428199509054439 [doi]","Leukemia & lymphoma"
"63","24349229","Resistance to ROS1 inhibition mediated by EGFR pathway activation in","The targeting of oncogenic 'driver' kinases with small molecule inhibitors has proven to be a highly effective therapeutic strategy in selected non-small cell lung cancer (NSCLC) patients. However, acquired resistance to targeted therapies invariably arises and is a major limitation to patient care. ROS1 fusion proteins are a recently described class of oncogenic driver, and NSCLC patients that express these fusions generally respond well to ROS1-targeted therapy. In this study, we sought to determine mechanisms of acquired resistance to ROS1 inhibition. To accomplish this, we analyzed tumor samples from a patient who initially responded to the ROS1 inhibitor crizotinib but eventually developed acquired resistance. In addition, we generated a ROS1 inhibition-resistant derivative of the initially sensitive NSCLC cell line HCC78. Previously described mechanisms of acquired resistance to tyrosine ","Carcinoma, Non-Small-Cell Lung/drug therapy/*metabolism/pathology, Cell Line, Tumor, Cell Proliferation/drug effects, Cell Survival/drug effects, Crizotinib, *Drug Resistance, Neoplasm/drug effects, Epidermal Growth Factor/pharmacology, ErbB Receptors/antagonists & inhibitors/*metabo","Davies KD, Mahale S, Astling DP, Aisner DL, Le AT, Hinz TK, Vaishnavi A, Bunn PA Jr, Heasley LE, Tan AC, Camidge DR, Varella-Garcia M, Doebele RC","PLoS One. 2013 Dec 13;8(12):e82236. doi","2013","10.1371/journal.pone.0082236 [doi], PONE-D-13-25178 [pii]","PloS one"
"64","8289484","Establishment of a new cell line with the characteristics of a multi","A novel cell line (KH88) was established from a patient with chronic myelogenous leukemia in blastic crisis. The leukemic blasts had the features of undifferentiated blasts with basophilic agranular cytoplasm and they were focally positive for acid phosphatase and alpha-naphthyl acetate esterase. CD36, CD33, HLADR, and CD71 were expressed on the surfaces of the blast cells. Most blasts were positive for platelet peroxidase activity, and some of them had granules containing aggregates of ferritin molecules. These findings were compatible with those of 'early' erythroblastic leukemia, this established cell line (KH88) having similar characteristics, and actually producing hemoglobin A and hemoglobin F. Although the KH88 cells were negative for megakaryocytic markers, they were induced to express CD41 by phorbol ester. Further, a few KH88 cells were positive for myeloperoxidase. This cell line was","Aged, Antigens, Surface/analysis, Base Sequence, *Blast Crisis, Cell Differentiation/drug effects/physiology, Granulocytes/cytology, Hemoglobins/biosynthesis, Histocytochemistry, Humans, Interleukin-3/genetics, Karyotyping, Leukemia, Erythroblastic, Acute/genetics/metabolism/*patholo","Furukawa T, Koike T, Ying W, Kishi K, Aoki S, Gotoh T, Hashimoto S, Saitoh H, Hanano M, Shinada S, et al.","Leukemia. 1994 Jan;8(1):171-80.","1994 Jan","?","Leukemia"
"65","28960893","Crizotinib targets in glioblastoma stem cells.","Glioblastoma stem cells (GSCs) are believed to be involved in the mechanisms of tumor resistance, therapeutic failures, and recurrences after conventional glioblastoma therapy. Therefore, elimination of GSCs might be a prerequisite for the development of successful therapeutic strategies. ALK, ROS1, and MET are targeted by Crizotinib, a tyrosine kinase inhibitor which has been approved for treatment of ALK-rearranged non-small-cell lung cancer. In this study we investigated ALK, ROS1, and MET status in nine glioblastoma stem cell lines and tumors from which they arise. Fluorescent in situ hybridization (FISH), Sanger's direct sequencing, and immunohistochemistry were used to screen genomic rearrangements (or amplifications), genomic mutations, and protein expression, respectively. The immunohistochemical and FISH studies revealed no significant dysregulation of ROS1 in GSCs and associated tumor","Aged, Anaplastic Lymphoma Kinase, Cell Line, Tumor, Central Nervous System Neoplasms/*drug therapy/genetics/metabolism, Crizotinib, DNA Mutational Analysis, Female, Glioblastoma/*drug therapy/genetics/metabolism, Humans, Male, Middle Aged, Molecular Targeted Therapy, Neoplastic Stem ","Junca A, Villalva C, Tachon G, Rivet P, Cortes U, Guilloteau K, Balbous A, Godet J, Wager M, Karayan-Tapon L","Cancer Med. 2017 Nov;6(11):2625-2634. doi","2017 Nov","10.1002/cam4.1167 [doi]","Cancer medicine"
"66","22919003","Identifying and targeting ROS1 gene fusions in non-small cell lung c","PURPOSE: Oncogenic gene fusions involving the 3' region of ROS1 kinase have been identified in various human cancers. In this study, we sought to characterize ROS1 fusion genes in non-small cell lung cancer (NSCLC) and establish the fusion proteins as drug targets. EXPERIMENTAL DESIGN: An NSCLC tissue microarray (TMA) panel containing 447 samples was screened for ROS1 rearrangement by FISH. This assay was also used to screen patients with NSCLC. In positive samples, the identity of the fusion partner was determined through inverse PCR and reverse transcriptase PCR. In addition, the clinical efficacy of ROS1 inhibition was assessed by treating a ROS1-positive patient with crizotinib. The HCC78 cell line, which expresses the SLC34A2-ROS1 fusion, was treated with kinase inhibitors that have activity against ROS1. The effects of ROS1 inhibition on proliferation, cell-cycle progression, and cell sig","Adult, Aged, Antigens, Differentiation, B-Lymphocyte/genetics, *Carcinoma, Non-Small-Cell Lung/genetics/metabolism/pathology/therapy, Cell Cycle/drug effects/genetics, Cell Proliferation/drug effects, Crizotinib, Female, Histocompatibility Antigens Class II/genetics, Humans, Male, Mi","Davies KD, Le AT, Theodoro MF, Skokan MC, Aisner DL, Berge EM, Terracciano LM, Cappuzzo F, Incarbone M, Roncalli M, Alloisio M, Santoro A, Camidge DR, Varella-Garcia M, Doebele RC","Clin Cancer Res. 2012 Sep 1;18(17):4570-9. doi","2012 Sep","1078-0432.CCR-12-0550 [pii], 10.1158/1078-0432.CCR-12-0550 [doi]","Clinical cancer research"
"67","9427720","Suppression of cell proliferation and the expression of a bcr-abl fu","A new human leukemia cell line, KT-1, was established from a patient in the blastic crisis phase of chronic myelogenous leukemia (CML). This cell line had a positive reaction for intracytoplasmic myeloperoxidase and two Philadelphia chromosomes (Ph1) [t(9;22)(q34;q11)] and lacked normal copies of chromosomes 9 and 22. Molecular characterization of the breakpoint in the t(9;22)(q34;q11) showed that KT-1 had a bcr-2/abl-2 splice junction. When the KT-1 cells were cultured with interferon (IFN)-alpha or IFN-gamma, the growth of the cells were dose-dependently suppressed. IFN-alpha and IFN-gamma exerted synergistic suppressive effects on the growth of KT-1 cells. Furthermore, IFN-alpha suppressed the expression of the bcr-abl fusion gene in KT-1 cells, and induced G1 cell-cycle arrest and apoptotic cell death. The KT-1 cell line should be a valuable tool for studying the molecular mechanism of the ","Apoptosis/*drug effects, Cell Division/drug effects, Fusion Proteins, bcr-abl/*genetics, Gene Expression Regulation, Neoplastic/*drug effects, Humans, Interferon-alpha/*pharmacology, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/*pathology, Tumor Cells, Cultured","Yanagisawa K, Yamauchi H, Kaneko M, Kohno H, Hasegawa H, Fujita S","Blood. 1998 Jan 15;91(2):641-8.","1998 Jan","?","Blood"
"68","23533265","Targeted inhibition of the molecular chaperone Hsp90 overcomes ALK i","UNLABELLED: EML4-ALK gene rearrangements define a unique subset of patients with non-small cell lung carcinoma (NSCLC), and the clinical success of the anaplastic lymphoma kinase (ALK) inhibitor crizotinib in this population has become a paradigm for molecularly targeted therapy. Here, we show that the Hsp90 inhibitor ganetespib induced loss of EML4-ALK expression and depletion of multiple oncogenic signaling proteins in ALK-driven NSCLC cells, leading to greater in vitro potency, superior antitumor efficacy, and prolonged animal survival compared with results obtained with crizotinib. In addition, combinatorial benefit was seen when ganetespib was used with other targeted ALK agents both in vitro and in vivo. Importantly, ganetespib overcame multiple forms of crizotinib resistance, including secondary ALK mutations, consistent with activity seen in a patient with crizotinib-resistant NSCLC. Ca","Adult, Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/*administration & dosage, Carcinoma, Non-Small-Cell Lung/*drug therapy/genetics/pathology, Cell Line, Tumor, Crizotinib, Drug Resistance, Neoplasm, Female, HSP90 Heat-Shock Proteins/*antagonists & inhibitors, Humans, L","Sang J, Acquaviva J, Friedland JC, Smith DL, Sequeira M, Zhang C, Jiang Q, Xue L, Lovly CM, Jimenez JP, Shaw AT, Doebele RC, He S, Bates RC, Camidge DR, Morris SW, El-Hariry I, Proia DA","Cancer Discov. 2013 Apr;3(4):430-43. doi","2013 Apr","2159-8290.CD-12-0440 [pii], 10.1158/2159-8290.CD-12-0440 [doi]","Cancer discovery"
"69","29089259","Trisubstituted purine inhibitors of PDGFRalpha and their antileukemi","Inhibition of protein kinases is a validated concept for pharmacological intervention in cancers. Many kinase inhibitors have been approved for clinical use, but their practical application is often limited. Here, we describe a collection of 23 novel 2,6,9-trisubstituted purine derivatives with nanomolar inhibitory activities against PDGFRalpha, a receptor tyrosine kinase often found constitutively activated in various tumours. The compounds demonstrated strong and selective cytotoxicity in the human eosinophilic leukemia cell line EOL-1, whereas several other cell lines were substantially less sensitive. The cytotoxicity in EOL-1, which is known to express the FIP1L1-PDGFRA fusion gene encoding an oncogenic kinase, correlated significantly with PDGFRalpha inhibition. EOL-1 cells treated with the compounds also exhibited dose-dependent inhibition of PDGFRalpha autophosphorylation and suppressio","Antineoplastic Agents/chemical synthesis/chemistry/*pharmacology, Cell Proliferation/drug effects, Dose-Response Relationship, Drug, Drug Screening Assays, Antitumor, Humans, Molecular Structure, Protein Kinase Inhibitors/chemical synthesis/chemistry/*pharmacology, Purines/chemical s","Malinkova V, Reznickova E, Jorda R, Gucky T, Krystof V","Bioorg Med Chem. 2017 Dec 15;25(24):6523-6535. doi","2017 Dec","S0968-0896(17)31763-7 [pii], 10.1016/j.bmc.2017.10.032 [doi]","Bioorganic & medicinal chemistry"
"70","10688835","Induction of resistance to the Abelson inhibitor STI571 in human leu","The 2-phenylaminopyrimidine derivative STI571 has been shown to selectively inhibit the tyrosine kinase domain of the oncogenic bcr/abl fusion protein. The activity of this inhibitor has been demonstrated so far both in vitro with bcr/abl expressing cells derived from leukemic patients, and in vivo on nude mice inoculated with bcr/abl positive cells. Yet, no information is available on whether leukemic cells can develop resistance to bcr/abl inhibition. The human bcr/abl expressing cell line LAMA84 was cultured with increasing concentrations of STI571. After approximately 6 months of culture, a new cell line was obtained and named LAMA84R. This newly selected cell line showed an IC50 for the STI571 (1.0 microM) 10-fold higher than the IC50 (0.1 microM) of the parental sensitive cell line. Treatment with STI571 was shown to increase both the early and late apoptotic fraction in LAMA84 but not in","Adenosine Triphosphate/metabolism, Allosteric Site/genetics, Antineoplastic Agents/*pharmacology, Apoptosis/drug effects, Base Sequence, Caspase 3, Caspases/metabolism, Cell Division, Doxorubicin/pharmacology, Drug Resistance, Neoplasm/*genetics, Enzyme Activation/drug effects, Fusio","le Coutre P, Tassi E, Varella-Garcia M, Barni R, Mologni L, Cabrita G, Marchesi E, Supino R, Gambacorti-Passerini C","Blood. 2000 Mar 1;95(5):1758-66.","2000 Mar","?","Blood"
"71","10766197","BCR-ABL tyrosine kinase activity regulates the expression of multipl","The BCR-ABL chimeric protein is thought to play a central role in the pathogenesis of Philadelphia (Ph) chromosome-positive leukemias, notably chronic myeloid leukemia (CML). There is compelling evidence that malignant transformation by BCR-ABL is critically dependent on its protein tyrosine kinase (PTK) activity. As a result, multiple signaling pathways are activated in a kinase-dependent manner, and thus the activation of such pathways may affect the expression of genes that confer the malignant phenotype. In this study, we used differential display to investigate the alterations of gene expression in BV173, a CML cell line derived from lymphoid blast crisis, after exposure to ST1571, which selectively inhibits ABL PTK activity. We show that the expression of a set of 12 genes is correlated with the kinase activity and that the profile of these genes reflects mechanisms implicated in the path","Antineoplastic Agents/toxicity, Blast Crisis/genetics, Fusion Proteins, bcr-abl/*metabolism, *Gene Expression Regulation, Neoplastic/drug effects, Humans, Jurkat Cells, Kinetics, Leukemia, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/pathology, Philadelphia Chromosome, ","Deininger MW, Vieira S, Mendiola R, Schultheis B, Goldman JM, Melo JV","Cancer Res. 2000 Apr 1;60(7):2049-55.","2000 Apr","?","Cancer research"
"72","25421750","Treatment Efficacy and Resistance Mechanisms Using the Second-Genera","UNLABELLED: ALK is a tyrosine kinase receptor involved in a broad range of solid and hematologic tumors. Among 70% to 80% of ALK(+) anaplastic large cell lymphomas (ALCL) are caused by the aberrant oncogenic fusion protein NPM-ALK. Crizotinib was the first clinically relevant ALK inhibitor, now approved for the treatment of late-stage and metastatic cases of lung cancer. However, patients frequently develop drug resistance to Crizotinib, mainly due to the appearance of point mutations located in the ALK kinase domain. Fortunately, other inhibitors are available and in clinical trial, suggesting the potential for second-line therapies to overcome Crizotinib resistance. This study focuses on the ongoing phase I/II trial small-molecule tyrosine kinase inhibitor (TKI) AP26113, by Ariad Pharmaceuticals, which targets both ALK and EGFR. Two NPM-ALK(+) human cell lines, KARPAS-299 and SUP-M2, were gro","Amino Acid Substitution, Anaplastic Lymphoma Kinase, Cell Line, Tumor, *Drug Resistance, Neoplasm, Exome, Humans, Inhibitory Concentration 50, Lymphoma, Large-Cell, Anaplastic/drug therapy/*genetics, Organophosphorus Compounds/*pharmacology, *Point Mutation, Protein-Tyrosine Kinases/","Ceccon M, Mologni L, Giudici G, Piazza R, Pirola A, Fontana D, Gambacorti-Passerini C","Mol Cancer Res. 2015 Apr;13(4):775-83. doi","2015 Apr","1541-7786.MCR-14-0157 [pii], 10.1158/1541-7786.MCR-14-0157 [doi]","Molecular cancer research"
"73","26265449","RAF-1 promotes survival of thyroid cancer cells harboring RET/PTC1 r","Thyroid cancer (TC) is frequently associated with BRAF or RAS oncogenic mutations and RET/PTC rearrangements, with aberrant RAF-MEK-ERK and/or PI3K pathway activation. BRAF underlies ERK activation in most TC cells, but not in TPC-1 cells with RET/PTC1 rearrangement. Here, we show that depletion of RAF-1, a RAF family member with a poorly defined role in TC, decreases proliferation and increases apoptosis in TPC-1 cells and, less significantly, in cells harboring a BRAF(V600E) or HRAS(G13R) mutations, but without affecting ERK activation. We further demonstrate that constitutive activation of ERKs in TPC-1 cells is not caused by mutations in 50 oncogenes and tumor suppressors prone to activate the ERK pathway, or affected by inhibition of BRAF, MEK1/2 or PI3K. Our data indicate that RAF-1 is important for the survival of TPC-1 cells independently of the classical MEK1/2-ERK activation, offering","Apoptosis, Carcinoma/*genetics/metabolism, Carcinoma, Papillary, Cell Line, Tumor, Cell Proliferation, Cell Survival, Humans, MAP Kinase Signaling System, Oncogene Proteins, Fusion/*genetics, Protein-Tyrosine Kinases/*genetics, Proto-Oncogene Proteins c-raf/genetics/*metabolism, Thyr","Castro L, Alves S, Chaves SR, Costa JL, Soares P, Preto A","Mol Cell Endocrinol. 2015 Nov 5;415:64-75. doi","2015 Nov","S0303-7207(15)30046-0 [pii], 10.1016/j.mce.2015.08.006 [doi]","Molecular and cellular endocrinology"
"74","27555670","Effect of Interferon-gamma on the Basal and the TNFalpha-Stimulated ","CXCL8 displays several tumor-promoting effects. Targeting and/or lowering CXCL8 concentrations within the tumor microenvironment would produce a therapeutic benefit. Aim of this study was to test the effect of IFNgamma on the basal and TNFalpha-stimulated secretion of CXCL8 in TCP-1 and BCPAP thyroid cancer cell lines (harboring RET/PTC rearrangement and BRAF V600e mutation, resp.). Cells were incubated with IFNgamma (1, 10, 100, and 1000 U/mL) alone or in combination with TNF-alpha (10 ng/mL) for 24 hours. CXCL8 and CXCL10 concentrations were measured in the cell supernatants. IFNgamma inhibited in a dose-dependent and significant manner both the basal (ANOVA F: 22.759; p < 0.00001) and the TNFalpha-stimulated (ANOVA F: 15.309; p < 0.00001) CXCL8 secretions in BCPAP but not in TPC-1 cells (NS). On the other hand, IFNgamma and IFNgamma + TNF-alpha induced a significant secretion of CXCL10 in bo","Cell Line, Tumor, Cell Movement, Chemokine CXCL10/metabolism, Enzyme-Linked Immunosorbent Assay/methods, Gene Expression Regulation, Neoplastic, *Gene Rearrangement, Humans, Interferon-gamma/*pharmacology, Interleukin-8/*metabolism, Mutation, Proto-Oncogene Proteins B-raf/*genetics, ","Rotondi M, Coperchini F, Awwad O, Pignatti P, Di Buduo CA, Abbonante V, Magri F, Balduini A, Chiovato L","Mediators Inflamm. 2016;2016:8512417. doi","2016","10.1155/2016/8512417 [doi]","Mediators of inflammation"
"75","25198091","Real-time analysis of imatinib- and dasatinib-induced effects on chr","Attachment of stem leukemic cells to the bone marrow extracellular matrix increases their resistance to chemotherapy and contributes to the disease persistence. In chronic myelogenous leukemia (CML), the activity of the fusion BCR-ABL kinase affects adhesion signaling. Using real-time monitoring of microimpedance, we studied in detail the kinetics of interaction of human CML cells (JURL-MK1, MOLM-7) and of control BCR-ABL-negative leukemia cells (HEL, JURKAT) with fibronectin-coated surface. The effect of two clinically used kinase inhibitors, imatinib (a relatively specific c-ABL inhibitor) and dasatinib (dual ABL/SRC family kinase inhibitor), on cell binding to fibronectin is described. Both imatinib and low-dose (several nM) dasatinib reinforced CML cell interaction with fibronectin while no significant change was induced in BCR-ABL-negative cells. On the other hand, clinically relevant dose","Antineoplastic Agents/*pharmacology, Cell Adhesion/drug effects, Cell Line, Tumor, Dasatinib/*pharmacology, Fibronectins/*metabolism, Humans, Imatinib Mesylate/*pharmacology, Kinetics, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*pathology, Phosphorylation/drug effects, Protein ","Obr A, Roselova P, Grebenova D, Kuzelova K","PLoS One. 2014 Sep 8;9(9):e107367. doi","2014","10.1371/journal.pone.0107367 [doi], PONE-D-14-23040 [pii]","PloS one"
"76","29237803","Antitumor Activity of Entrectinib, a Pan-TRK, ROS1, and ALK Inhibito","Activation of tropomyosin receptor kinase (TRK) family tyrosine kinases by chromosomal rearrangement has been shown to drive a wide range of solid tumors and hematologic malignancies. TRK fusions are actionable targets as evidenced by recent clinical trial results in solid tumors. Entrectinib (RXDX-101) is an investigational, orally available, CNS-active, highly potent, and selective kinase inhibitor against TRKA/B/C, ROS1, and ALK kinase activities. Here, we demonstrate that TRK kinase inhibition by entrectinib selectively targets preclinical models of TRK fusion-driven hematologic malignancies. In acute myelogenous leukemia (AML) cell lines with endogenous expression of the ETV6-NTRK3 fusion gene, entrectinib treatment blocked cell proliferation and induced apoptotic cell death in vitro with subnanomolar IC50 values. Phosphorylation of the ETV6-TRKC fusion protein and its downstream signaling","Animals, Benzamides/pharmacology/*therapeutic use, Cell Line, Tumor, Female, Humans, Indazoles/pharmacology/*therapeutic use, Leukemia, Myeloid, Acute/*drug therapy/genetics/pathology, Mice, Mice, SCID, Oncogene Proteins, Fusion/*genetics, Protein Kinase Inhibitors/pharmacology/*ther","Smith KM, Fagan PC, Pomari E, Germano G, Frasson C, Walsh C, Silverman I, Bonvini P, Li G","Mol Cancer Ther. 2018 Feb;17(2):455-463. doi","2018 Feb","1535-7163.MCT-17-0419 [pii], 10.1158/1535-7163.MCT-17-0419 [doi]","Molecular cancer therapeutics"
"77","28073897","Identification of ALK, ROS1, and RET Fusions by a Multiplexed mRNA-B","BACKGROUND: Anaplastic lymphoma receptor tyrosine kinase (ALK), ROS proto-oncogene 1, receptor tyrosine kinase (ROS1), and ret proto-oncogene (RET) fusions are present in 5%-7% of patients with advanced non-small-cell lung cancer (NSCLC); their accurate identification is critical to guide targeted therapies. FISH and immunohistochemistry (IHC) are considered the gold standards to determine gene fusions, but they have limitations. The nCounter platform is a potentially useful genomic tool for multiplexed detection of gene fusions, but has not been validated in the clinical setting. METHODS: Formalin-fixed, paraffin embedded (FFPE) samples from 108 patients with advanced NSCLC were analyzed with an nCounter-based assay and the results compared with FISH, IHC, and reverse transcription PCR (RT-PCR). Data on response to fusion kinase inhibitors was retrospectively collected in a subset of 29 patien","Anaplastic Lymphoma Kinase, Carcinoma, Non-Small-Cell Lung/*genetics, Cell Line, Tumor, Formaldehyde, Humans, Immunohistochemistry, In Situ Hybridization, Fluorescence, Lung Neoplasms/genetics, Oncogene Proteins, Fusion/*genetics, *Paraffin Embedding, Protein-Tyrosine Kinases/*geneti","Reguart N, Teixido C, Gimenez-Capitan A, Pare L, Galvan P, Viteri S, Rodriguez S, Peg V, Aldeguer E, Vinolas N, Remon J, Karachaliou N, Conde E, Lopez-Rios F, Nadal E, Merkelbach-Bruse S, Buttner R, Rosell R, Molina-Vila MA, Prat A","Clin Chem. 2017 Mar;63(3):751-760. doi","2017 Mar","clinchem.2016.265314 [pii], 10.1373/clinchem.2016.265314 [doi]","Clinical chemistry"
"78","18594010","EML4-ALK fusion gene and efficacy of an ALK kinase inhibitor in lung","PURPOSE: The EML4-ALK fusion gene has been detected in approximately 7% of Japanese non-small cell lung cancers (NSCLC). We determined the frequency of EML4-ALK in Caucasian NSCLC and in NSCLC cell lines. We also determined whether TAE684, a specific ALK kinase inhibitor, would inhibit the growth of EML4-ALK-containing cell lines in vitro and in vivo. EXPERIMENTAL DESIGN: We screened 305 primary NSCLC [both U.S. (n = 138) and Korean (n = 167) patients] and 83 NSCLC cell lines using reverse transcription-PCR and by exon array analyses. We evaluated the efficacy of TAE684 against NSCLC cell lines in vitro and in vivo. RESULTS: We detected four different variants, including two novel variants, of EML4-ALK using reverse transcription-PCR in 8 of 305 tumors (3%) and 3 of 83 (3.6%) NSCLC cell lines. All EML4-ALK-containing tumors and cell lines were adenocarcinomas. EML4-ALK was detected more frequen","Aged, Antineoplastic Agents/*pharmacology, Apoptosis, Carcinoma, Non-Small-Cell Lung/*drug therapy/*enzymology, Cell Line, Tumor, Enzyme Inhibitors/*pharmacology, Female, *Gene Expression Regulation, Enzymologic, Humans, Lung Neoplasms/*drug therapy/*enzymology, Male, Middle Aged, On","Koivunen JP, Mermel C, Zejnullahu K, Murphy C, Lifshits E, Holmes AJ, Choi HG, Kim J, Chiang D, Thomas R, Lee J, Richards WG, Sugarbaker DJ, Ducko C, Lindeman N, Marcoux JP, Engelman JA, Gray NS, Lee C, Meyerson M, Janne PA","Clin Cancer Res. 2008 Jul 1;14(13):4275-83. doi","2008 Jul","14/13/4275 [pii], 10.1158/1078-0432.CCR-08-0168 [doi]","Clinical cancer research"
"79","26939704","Entrectinib, a Pan-TRK, ROS1, and ALK Inhibitor with Activity in Mul","Activated ALK and ROS1 tyrosine kinases, resulting from chromosomal rearrangements, occur in a subset of non-small cell lung cancers (NSCLC) as well as other tumor types and their oncogenic relevance as actionable targets has been demonstrated by the efficacy of selective kinase inhibitors such as crizotinib, ceritinib, and alectinib. More recently, low-frequency rearrangements of TRK kinases have been described in NSCLC, colorectal carcinoma, glioblastoma, and Spitzoid melanoma. Entrectinib, whose discovery and preclinical characterization are reported herein, is a novel, potent inhibitor of ALK, ROS1, and, importantly, of TRK family kinases, which shows promise for therapy of tumors bearing oncogenic forms of these proteins. Proliferation profiling against over 200 human tumor cell lines revealed that entrectinib is exquisitely potent in vitro against lines that are dependent on the drug's ph","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/*pharmacology, Benzamides/chemistry/*pharmacology, Cell Line, Tumor, Colorectal Neoplasms/drug therapy/genetics/metabolism/pathology, Disease Models, Animal, Enzyme Activation/drug effects, Humans, Indazoles/chemistry/*pharma","Ardini E, Menichincheri M, Banfi P, Bosotti R, De Ponti C, Pulci R, Ballinari D, Ciomei M, Texido G, Degrassi A, Avanzi N, Amboldi N, Saccardo MB, Casero D, Orsini P, Bandiera T, Mologni L, Anderson D, Wei G, Harris J, Vernier JM, Li G, Felder E, Donati D, Isacchi A, Pesenti E, Magnaghi P, Galvani A","Mol Cancer Ther. 2016 Apr;15(4):628-39. doi","2016 Apr","1535-7163.MCT-15-0758 [pii], 10.1158/1535-7163.MCT-15-0758 [doi]","Molecular cancer therapeutics"
"80","26750252","Design and synthesis of novel selective anaplastic lymphoma kinase i","Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase belonging to the insulin receptor superfamily. Expression of ALK in normal human tissues is only found in a subset of neural cells, however it is involved in the genesis of several cancers through genetic aberrations involving translocation of the kinase domain with multiple fusion partners (e.g., NPM-ALK in anaplastic large cell lymphoma ALCL or EML4-ALK in non-small cell lung cancer) or activating mutations in the full-length receptor resulting in ligand-independent constitutive activation (e.g., neuroblastoma). Here we are reporting the discovery of novel and selective anaplastic lymphoma kinase inhibitors from specific modifications of the 2,4-diaminopyridine core present in TAE684 and LDK378. Synthesis, structure activity relationships (SAR), absorption, distribution, metabolism, and excretion (ADME) profile, and in vivo effica","4-Aminopyridine/analogs & derivatives/chemistry, Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/*chemical synthesis/pharmacokinetics/therapeutic use, Binding Sites, Cell Line, Tumor, Crystallography, X-Ray, *Drug Design, Half-Life, Humans, Lymphoma, Large-Cell, Anaplastic","Michellys PY, Chen B, Jiang T, Jin Y, Lu W, Marsilje TH, Pei W, Uno T, Zhu X, Wu B, Nguyen TN, Bursulaya B, Lee C, Li N, Kim S, Tuntland T, Liu B, Sun F, Steffy A, Hood T","Bioorg Med Chem Lett. 2016 Feb 1;26(3):1090-1096. doi","2016 Feb","S0960-894X(15)30257-2 [pii], 10.1016/j.bmcl.2015.11.049 [doi]","Bioorganic & medicinal chemistry letters"
"81","26791794","Responses to the multitargeted MET/ALK/ROS1 inhibitor crizotinib and","INTRODUCTION: Genomic aberrations involving ALK, ROS1 and MET can be driver oncogenes in lung adenocarcinomas. Identification of tyrosine kinase inhibitors (TKIs) with activity against these tumors and of preclinical systems to model response are warranted. METHODS: We analyzed cases with lung adenocarcinomas for representative genomic aberrations, evaluated the response to the multitargeted MET/ALK/ROS1 crizotinib TKI in cases with MET aberrations and profiled lung cancer cell lines with the aforementioned genomic changes. RESULTS: Lung cancer cell lines with ALK rearrangement, ROS1 rearrangement or MET amplification had expected in vitro responses to crizotinib and the ALK/ROS1 TKI ceritinib. However, a commercially-available cell line with MET exon 14 skipping mutation and co-occurring PIK3CA-p.Glu545Lys mutation did not respond to crizotinib; suggesting the latter abrogated response. 10% of","Adenocarcinoma/*drug therapy/*genetics, Adenocarcinoma of Lung, *Alternative Splicing, Anaplastic Lymphoma Kinase, Antineoplastic Agents/pharmacology/*therapeutic use, Cell Line, Tumor, Cell Survival/drug effects, *Gene Amplification, Genomic Instability, Genotype, Humans, Lung Neopl","Jorge SE, Schulman S, Freed JA, VanderLaan PA, Rangachari D, Kobayashi SS, Huberman MS, Costa DB","Lung Cancer. 2015 Dec;90(3):369-74. doi","2015 Dec","S0169-5002(15)30096-9 [pii], 10.1016/j.lungcan.2015.10.028 [doi]","Lung cancer (Amsterdam, Netherlands)"
"82","24112608","Prognostic significance and therapeutic potential of the activation ","BACKGROUND: Activation of the protein kinase B/mammalian target of rapamycin (AKT/mTOR) pathway has been demonstrated to be involved in nucleophosmin-anaplastic lymphoma kinase (NPM-ALK)-mediated tumorigenesis in anaplastic large cell lymphoma (ALCL) and correlated with unfavorable outcome in certain types of other cancers. However, the prognostic value of AKT/mTOR activation in ALCL remains to be fully elucidated. In the present study, we aim to address this question from a clinical perspective by comparing the expressions of the AKT/mTOR signaling molecules in ALCL patients and exploring the therapeutic significance of targeting the AKT/mTOR pathway in ALCL. METHODS: A cohort of 103 patients with ALCL was enrolled in the study. Expression of ALK fusion proteins and the AKT/mTOR signaling phosphoproteins was studied by immunohistochemical (IHC) staining. The pathogenic role of ALK fusion prote","Adaptor Proteins, Signal Transducing/metabolism, Adolescent, Adult, Aged, Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/pharmacology, Cell Line, Tumor, Child, Child, Preschool, Drug Resistance, Neoplasm/genetics, Enzyme Activation, Female, Gene Expression, Humans, Immuno","Gao J, Yin M, Zhu Y, Gu L, Zhang Y, Li Q, Jia C, Ma Z","BMC Cancer. 2013 Oct 10;13:471. doi","2013 Oct","1471-2407-13-471 [pii], 10.1186/1471-2407-13-471 [doi]","BMC cancer"
"83","29665256","BCR-ABL enhances the prolyl isomerase activity of Pin 1 by interacti","Philadelphia chromosome (Ph)/BCR-ABL-positive (ph(+) ) ALL is the most common genetic abnormality associated with ALL and has been shown to confer the worst prognosis to both children and adults. Increasing evidence has revealed that the dysregulation of prolyl isomerase Pin 1 contributes to multicancer development and progression, including ALL, although the underlying molecular mechanisms remain unclear. Here, we report that the expression of Pin 1 was enhanced in ph(+) ALL patient samples and was associated positively with the expression of BCR-ABL. Genetically or pharmacologically inhibiting Pin 1 expression or activity produces potent therapeutic efficacy against ph(+) ALL. We further demonstrated that BCR-ABL enhances the prolyl isomerase activity of Pin 1 by decreasing the phosphorylated level of Pin 1 at Ser 71 and interacting with DAPK1. The inhibition of BCR-ABL activity by imatinib i","Adolescent, Adult, Apoptosis/genetics, Cell Line, Tumor, Cell Proliferation/genetics, Death-Associated Protein Kinases/*metabolism, Enzyme Activation, Female, Fusion Proteins, bcr-abl/antagonists & inhibitors/*genetics/metabolism, Humans, Imatinib Mesylate/pharmacology, Male, Middle ","Cao WB, Yao JF, Feng SZ, He Y, Jiang EL, Zhang RL, Yang DL, Gong M, Zheng XH, Chen SL, Sun JL, Zhou LK, Han MZ","Cancer Med. 2018 Jun;7(6):2530-2540. doi","2018 Jun","10.1002/cam4.1478 [doi]","Cancer medicine"
"84","24556908","Induction of autophagy contributes to crizotinib resistance in ALK-p","Use of the inhibitor of ALK fusion onco-protein, crizotinib (PF02341066), has achieved impressive clinical efficacy in patients with ALK-positive non-small cell lung cancer. Nevertheless, acquired resistance to this drug occurs inevitably in approximately a year, limiting the therapeutic benefits of this novel targeted therapy. In this study, we found that autophagy was induced in crizonitib-resistant lung cancer cells and contributed to drug resistance. We observed that ALK was downregulated in the crizotinib-resistant lung cancer cell line, H3122CR-1, and this was causally associated with autophagy induction. The degree of crizotinib resistance correlated with autophagic activity. Activation of autophagy in crizotinib-resistant H3122CR-1 cells involved alteration of the Akt/mTOR signaling pathway. Furthermore, we demonstrated that chloroquine, an inhibitor of autophagy, could restore sensitiv","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/*pharmacology, Autophagy/*drug effects, Cell Line, Tumor, Chloroquine/pharmacology, Crizotinib, Down-Regulation, Drug Resistance, Neoplasm/*drug effects, Female, Heterografts, Humans, Lung Neoplasms/drug therapy/*pathology, M","Ji C, Zhang L, Cheng Y, Patel R, Wu H, Zhang Y, Wang M, Ji S, Belani CP, Yang JM, Ren X","Cancer Biol Ther. 2014 May;15(5):570-7. doi","2014 May","28162 [pii], 10.4161/cbt.28162 [doi]","Cancer biology & therapy"
"85","28181564","Multiplexed transcriptome analysis to detect ALK, ROS1 and RET rearr","ALK, ROS1 and RET gene fusions are important predictive biomarkers for tyrosine kinase inhibitors in lung cancer. Currently, the gold standard method for gene fusion detection is Fluorescence In Situ Hybridization (FISH) and while highly sensitive and specific, it is also labour intensive, subjective in analysis, and unable to screen a large numbers of gene fusions. Recent developments in high-throughput transcriptome-based methods may provide a suitable alternative to FISH as they are compatible with multiplexing and diagnostic workflows. However, the concordance between these different methods compared with FISH has not been evaluated. In this study we compared the results from three transcriptome-based platforms (Nanostring Elements, Agena LungFusion panel and ThermoFisher NGS fusion panel) to those obtained from ALK, ROS1 and RET FISH on 51 clinical specimens. Overall agreement of results r","Anaplastic Lymphoma Kinase, Cell Line, Tumor, *Gene Expression Profiling, *Gene Expression Regulation, Neoplastic, *Gene Rearrangement, Humans, In Situ Hybridization, Fluorescence, Lung Neoplasms/*genetics, Oncogene Proteins, Fusion/genetics, Protein-Tyrosine Kinases/*genetics/metabo","Rogers TM, Arnau GM, Ryland GL, Huang S, Lira ME, Emmanuel Y, Perez OD, Irwin D, Fellowes AP, Wong SQ, Fox SB","Sci Rep. 2017 Feb 9;7:42259. doi","2017 Feb","srep42259 [pii], 10.1038/srep42259 [doi]","Scientific reports"
"86","26208525","Antitumor Activity and Acquired Resistance Mechanism of Dovitinib (T","RET rearrangement is a newly identified oncogenic mutation in lung adenocarcinoma (LADC). Activity of dovitinib (TKI258), a potent inhibitor of FGFR, VEGFR, and PDGFR, in RET-rearranged LADC has not been reported. The aims of the study are to explore antitumor effects and mechanisms of acquired resistance of dovitinib in RET-rearranged LADC. Using structural modeling and in vitro analysis, we demonstrated that dovitinib induced cell-cycle arrest at G0-G1 phase and apoptosis by selective inhibition of RET kinase activity and ERK1/2 signaling in RET-rearranged LC-2/ad cells. Strong antitumor effect of dovitinib was observed in an LC-2/ad tumor xenograft model. To identify the acquired resistance mechanisms to dovitinib, LC-2/ad cells were exposed to increasing concentrations of dovitinib to generate LC-2/ad DR cells. Gene-set enrichment analysis of gene expression and phosphor-kinase revealed tha","Adenocarcinoma/*drug therapy/enzymology/pathology, Adenocarcinoma of Lung, Animals, Antineoplastic Agents/chemistry/*pharmacology, Apoptosis, Benzimidazoles/chemistry/*pharmacology, Catalytic Domain, Cell Cycle Checkpoints, Cell Line, Tumor, *Drug Resistance, Neoplasm, Enzyme Activat","Kang CW, Jang KW, Sohn J, Kim SM, Pyo KH, Kim H, Yun MR, Kang HN, Kim HR, Lim SM, Moon YW, Paik S, Kim DJ, Kim JH, Cho BC","Mol Cancer Ther. 2015 Oct;14(10):2238-48. doi","2015 Oct","1535-7163.MCT-15-0350 [pii], 10.1158/1535-7163.MCT-15-0350 [doi]","Molecular cancer therapeutics"
"87","27307395","Detection of t(9;22) b2a2 fusion transcript by flow cytometry.","INTRODUCTION: We assessed the feasibility of flow cytometry-fluorescent in situ hybridization technique in the detection of translocated mRNA in the cytoplasm of human peripheral blood nucleated cells. It is assumed that this assay can be applied as a diagnostic method in the detection of chromosomal translocation which commonly occurs in hematologic malignancies. METHODS: KCL-22 cell line and white blood cells from 21 CML patients were recruited in the study. Cells were isolated and fixed. After permeabilization, cells were resuspended in hybridization buffer and probes were added to the mixture. Subsequently, cells were washed and analyzed on the flow cytometer instrument. The flow cytometry results were compared with qRT-PCR and fluorescent microscope outcomes. RESULTS: Using the current principle, 97 +/- 2.1% of the KCL-22 cells were labeled with b2a2 mRNA-specific probes. In addition, seve","Cell Line, Tumor, *Chromosomes, Human, Pair 21, *Chromosomes, Human, Pair 9, Flow Cytometry/*methods, Fusion Proteins, bcr-abl/genetics, Humans, In Situ Hybridization, Fluorescence/methods, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*pathology, Leukocytes/chemistry/*pathology, ","Ranjbaran R, Okhovat MA, Abbasi M, Moezzi L, Aboualizadeh F, Amidzadeh Z, Golafshan HA, Behzad-Behbahani A, Sharifzadeh S","Int J Lab Hematol. 2016 Aug;38(4):403-11. doi","2016 Aug","10.1111/ijlh.12515 [doi]","International journal of laboratory hematology"
"88","17497325","Chronic myelomonocytic leukemia with p190 BCR-ABL rearrangement mimi","?","Bone Marrow Cells/immunology, Fusion Proteins, bcr-abl/*genetics, Gene Rearrangement/*genetics, Humans, Immunophenotyping, In Situ Hybridization, Fluorescence, Leukemia, Myelomonocytic, Chronic/*genetics, Liver/pathology, Male, Middle Aged, Monocytes, Reverse Transcriptase Polymerase","Alagiozian-Angelova V, Kadkol S, Lindgren V, Peace D, Gaitonde S","Acta Oncol. 2007;46(4):554-6. doi","2007","778490338 [pii], 10.1080/02841860601034842 [doi]","Acta oncologica (Stockholm, Sweden)"
"89","26202951","Cellular Mechanisms Underlying Complete Hematological Response of Ch","PURPOSE: Targeted MEK inhibition is an emerging therapy in a number of solid tumors. It holds particular promise in BRAF V600E mutation-positive malignant melanoma, where constitutive activation and cell growth through the MAP kinase (MAPK) pathway is well established. In vitro and preclinical research indicates that MAPK pathway activation is important in chronic myeloid leukemia (CML) leukemogenesis; however, the potential of MEK inhibition has not yet been investigated clinically in the setting of such hematologic malignancies. EXPERIMENTAL DESIGN: We report a case of complete hematologic response of CML to MEK inhibition in a patient with synchronous metastatic melanoma, who received treatment with combination BRAF and MEK1/2 inhibitors. We studied the effects of these agents on proliferation and outgrowth of myeloid precursors, and longitudinal shifts in peripheral blood phenotyping during","Adult, Antineoplastic Agents/pharmacology/*therapeutic use, Apoptosis Regulatory Proteins/genetics/metabolism, Bcl-2-Like Protein 11, Cell Line, Tumor, Cell Proliferation/drug effects, Fusion Proteins, bcr-abl/genetics/metabolism, Gene Expression Regulation, Neoplastic/drug effects, ","Andrews MC, Turner N, Boyd J, Roberts AW, Grigg AP, Behren A, Cebon J","Clin Cancer Res. 2015 Dec 1;21(23):5222-34. doi","2015 Dec","1078-0432.CCR-15-0393 [pii], 10.1158/1078-0432.CCR-15-0393 [doi]","Clinical cancer research"
"90","30053332","Combined effect of cabozantinib and gefitinib in crizotinib-resistan","The ROS1 tyrosine kinase inhibitor (TKI) crizotinib has shown dramatic effects in patients with non-small cell lung cancer (NSCLC) harboring ROS1 fusion genes. However, patients inevitably develop resistance to this agent. Therefore, a new treatment strategy is required for lung tumors with ROS1 fusion genes. In the present study, lung cancer cell lines, HCC78 harboring SLC34A2-ROS1 and ABC-20 harboring CD74-ROS1, were used as cell line-based resistance models. Crizotinib-resistant HCC78R cells were established from HCC78. We comprehensively screened the resistant cells using a phosphor-receptor tyrosine kinase array and RNA sequence analysis by next-generation sequencing. HCC78R cells showed upregulation of HB-EGF and activation of epidermal growth factor receptor (EGFR) phosphorylation and the EGFR signaling pathway. Recombinant HB-EGF or EGF rendered HCC78 cells or ABC-20 cells resistant to ","Anilides/pharmacology/therapeutic use, Animals, Antigens, Differentiation, B-Lymphocyte/genetics, Antineoplastic Combined Chemotherapy Protocols/*pharmacology/therapeutic use, Carcinoma, Non-Small-Cell Lung/*drug therapy/genetics/pathology, Cell Line, Tumor, Crizotinib, Drug Resistan","Kato Y, Ninomiya K, Ohashi K, Tomida S, Makimoto G, Watanabe H, Kudo K, Matsumoto S, Umemura S, Goto K, Ichihara E, Ninomiya T, Kubo T, Sato A, Hotta K, Tabata M, Toyooka S, Maeda Y, Kiura K","Cancer Sci. 2018 Oct;109(10):3149-3158. doi","2018 Oct","10.1111/cas.13752 [doi]","Cancer science"
"91","8547307","Cloning and sequencing of a tpr-met oncogene cDNA isolated from MNNG","A rearranged tpr-met oncogene was identified in a MNNG-transformed human Xeroderma pigmentosum (XP) cell line (ASKMN). A 2016 bp cDNA was cloned and sequenced, disclosing an ORF with a coding capacity for a 523 aa protein. The sequence of this tpr-met cDNA was very similar to that previously reported in another human MNNG-transformed cell line (MNNG-HOS).","Amino Acid Sequence, Base Sequence, Cell Line, Transformed, Cloning, Molecular, DNA, Complementary/biosynthesis/*isolation & purification, Fibroblasts/drug effects/*metabolism, Humans, *Methylnitronitrosoguanidine, Molecular Sequence Data, Oncogene Proteins, Fusion/*genetics","Wicker R, Bounacer A, Gascon A, Brison O, Sarasin A, Suarez HG","Biochim Biophys Acta. 1995 Dec 27;1264(3):254-6. doi","1995 Dec","0167-4781(95)00174-3 [pii], 10.1016/0167-4781(95)00174-3 [doi]","Biochimica et biophysica acta"
"92","26403224","HMGA2 as a potential molecular target in KMT2A-AFF1-positive infant ","Acute lymphoblastic leukaemia (ALL) in infants is an intractable cancer in childhood. Although recent intensive chemotherapy progress has considerably improved ALL treatment outcome, disease cure is often accompanied by undesirable long-term side effects, and efficient, less toxic molecular targeting therapies have been anticipated. In infant ALL cells with KMT2A (MLL) fusion, the microRNA let-7b (MIRLET7B) is significantly downregulated by DNA hypermethylation of its promoter region. We show here that the expression of HMGA2, one of the oncogenes repressed by MIRLET7B, is reversely upregulated in infant ALL leukaemic cells, particularly in KMT2A-AFF1 (MLL-AF4) positive ALL. In addition to the suppression of MIRLET7B, KMT2A fusion proteins positively regulate the expression of HMGA2. HMGA2 is one of the negative regulators of CDKN2A gene, which encodes the cyclin-dependent kinase inhibitor p16(","Azacitidine/pharmacology, Cell Line, Tumor, Cell Proliferation/drug effects, Cyclin-Dependent Kinase Inhibitor p16/metabolism/physiology, DNA Methylation/drug effects, DNA-Binding Proteins/metabolism, Drug Synergism, Gene Knockdown Techniques, Genes, p16, HMGA2 Protein/*antagonists &","Wu Z, Eguchi-Ishimae M, Yagi C, Iwabuki H, Gao W, Tauchi H, Inukai T, Sugita K, Ishii E, Eguchi M","Br J Haematol. 2015 Dec;171(5):818-29. doi","2015 Dec","10.1111/bjh.13763 [doi]","British journal of haematology"
"93","29045271","Rhabdomyosarcoma cells are susceptible to cell death by LDK378 alone","Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase that is often overexpressed in rhabdomyosarcoma (RMS). However, its oncogenic and functional role in RMS remains unclear. Therefore, we investigated the antitumor activity of LDK378 (ceritinib), a new second-generation ALK inhibitor approved for patients with ALK-positive non-small-cell lung cancers. Here, we report that LDK378 reduces cell viability and induces cell death in RMS cell lines at low micromolar IC50 concentrations irrespective of ALK expression levels or phosphorylation status. Compared with Karpas 299 non-Hodgkin's lymphoma cells carrying the NPM-ALK fusion gene, RMS cell lines proved to be far less sensitive to LDK378. The broad-range caspase inhibitor zVAD.fmk significantly protects RMS cells from LDK378-mediated cell death, indicating that LDK378 induces caspase-dependent apoptotic cell death. Before the onset of a","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Combined Chemotherapy Protocols/*pharmacology, Cell Death/drug effects, Cell Line, Tumor, Drug Synergism, Humans, Niacinamide/administration & dosage/*analogs & derivatives/pharmacology, Phenylurea Compounds/administration & dosage/","Dolgikh N, Fulda S","Anticancer Drugs. 2017 Nov;28(10):1118-1125. doi","2017 Nov","10.1097/CAD.0000000000000552 [doi], 00001813-201711000-00006 [pii]","Anti-cancer drugs"
"94","30115026","Simultaneous detection of lung fusions using a multiplex RT-PCR next","BACKGROUND: Gene fusion events resulting from chromosomal rearrangements play an important role in initiation of lung adenocarcinoma. The recent association of four oncogenic driver genes, ALK, ROS1, RET, and NTRK1, as lung tumor predictive biomarkers has increased the need for development of up-to-date technologies for detection of these biomarkers in limited amounts of material. METHODS: We describe here a multi-institutional study using the Ion AmpliSeq RNA Fusion Lung Cancer Research Panel to interrogate previously characterized lung tumor samples. RESULTS: Reproducibility between laboratories using diluted fusion-positive cell lines was 100%. A cohort of lung clinical research samples from different origins (tissue biopsies, tissue resections, lymph nodes and pleural fluid samples) were used to evaluate the panel. We observed 97% concordance for ALK (28/30 positive; 71/70 negative samples)","Anaplastic Lymphoma Kinase, Biomarkers, Tumor/*genetics, Biopsy, Cell Line, Tumor, Female, High-Throughput Nucleotide Sequencing, Humans, Lung Neoplasms/*genetics/pathology, Lymph Nodes/pathology, Male, Membrane Glycoproteins/genetics, *Multiplex Polymerase Chain Reaction, Oncogene P","Vaughn CP, Costa JL, Feilotter HE, Petraroli R, Bagai V, Rachiglio AM, Marino FZ, Tops B, Kurth HM, Sakai K, Mafficini A, Bastien RRL, Reiman A, Le Corre D, Boag A, Crocker S, Bihl M, Hirschmann A, Scarpa A, Machado JC, Blons H, Sheils O, Bramlett K, Ligtenberg MJL, Cree IA, Normanno N, Nishio K, Laurent-P","BMC Cancer. 2018 Aug 16;18(1):828. doi","2018 Aug","10.1186/s12885-018-4736-4 [doi], 10.1186/s12885-018-4736-4 [pii]","BMC cancer"
"95","26912052","Axitinib and sorafenib are potent in tyrosine kinase inhibitor resis","BACKGROUND: Chronic myeloid leukemia (CML) is driven by the fusion kinase Bcr-Abl. Bcr-Abl tyrosine kinase inhibitors (TKIs), such as imatinib mesylate (IM), revolutionized CML therapy. Nevertheless, about 20 % of CMLs display primary or acquired TKI resistance. TKI resistance can be either caused by mutations within the Bcr-Abl kinase domain or by aberrant signaling by its effectors, e.g. Lyn or Gab2. Bcr-Abl mutations are frequently observed in TKI resistance and can only in some cases be overcome by second line TKIs. In addition, we have previously shown that the formation of Gab2 complexes can be regulated by Bcr-Abl and that Gab2 signaling counteracts the efficacy of four distinct Bcr-Abl inhibitors. Therefore, TKI resistance still represents a challenge for disease management and alternative therapies are urgently needed. FINDINGS: Using different CML cell lines and models, we identified ","Adaptor Proteins, Signal Transducing/genetics/metabolism, Axitinib, Cell Line, Tumor, *Drug Resistance, Neoplasm, Fusion Proteins, bcr-abl/antagonists & inhibitors/genetics/metabolism, Humans, Imidazoles/*pharmacology, Indazoles/*pharmacology, Leukemia, Myelogenous, Chronic, BCR-ABL ","Halbach S, Hu Z, Gretzmeier C, Ellermann J, Wohrle FU, Dengjel J, Brummer T","Cell Commun Signal. 2016 Feb 24;14:6. doi","2016 Feb","10.1186/s12964-016-0129-y [doi], 10.1186/s12964-016-0129-y [pii]","Cell communication and signaling"
"96","23344087","Heterogeneity of genetic changes associated with acquired crizotinib","BACKGROUND: Anaplastic lymphoma kinase (ALK)-rearranged non-small-cell lung cancer (NSCLC) is markedly sensitive to the ALK inhibitor crizotinib. However, acquired resistance to crizotinib is inevitable through several mechanisms. Therefore, this study was conducted to identify genetic alterations associated with crizotinib resistance. METHODS: Tumor samples were derived from seven ALK-positive NSCLC patients who showed acquired resistance to crizotinib, and these patients were analyzed for ALK, EGFR, and KRAS mutations and ALK and EGFR gene amplifications. In vitro cytotoxicity of crizotinib and ALK downstream signals were compared between crizotinib-naive and -resistant NSCLC cells. RESULTS: After a median duration of 6 months (range, 4-12 months), seven ALK-positive NSCLC patients developed acquired resistance to crizotinib. Three patients harbored secondary ALK mutations, including one pati","Adenocarcinoma/drug therapy/*genetics/mortality, Adult, Anaplastic Lymphoma Kinase, Apoptosis, Biomarkers, Tumor/*genetics, Carcinoma, Non-Small-Cell Lung/drug therapy/*genetics/mortality, Cell Proliferation, Crizotinib, DNA, Neoplasm/genetics, Drug Resistance, Neoplasm/*genetics, Er","Kim S, Kim TM, Kim DW, Go H, Keam B, Lee SH, Ku JL, Chung DH, Heo DS","J Thorac Oncol. 2013 Apr;8(4):415-22. doi","2013 Apr","10.1097/JTO.0b013e318283dcc0 [doi], S1556-0864(15)32785-4 [pii]","Journal of thoracic oncology"
"97","26870817","P-glycoprotein Mediates Ceritinib Resistance in Anaplastic Lymphoma ","The anaplastic lymphoma kinase (ALK) fusion oncogene is observed in 3%-5% of non-small cell lung cancer (NSCLC). Crizotinib and ceritinib, a next-generation ALK tyrosine kinase inhibitor (TKI) active against crizotinib-refractory patients, are clinically available for the treatment of ALK-rearranged NSCLC patients, and multiple next-generation ALK-TKIs are currently under clinical evaluation. These ALK-TKIs exhibit robust clinical activity in ALK-rearranged NSCLC patients; however, the emergence of ALK-TKI resistance restricts the therapeutic effect. To date, various secondary mutations or bypass pathway activation-mediated resistance have been identified, but large parts of the resistance mechanism are yet to be identified. Here, we report the discovery of p-glycoprotein (P-gp/ABCB1) overexpression as a ceritinib resistance mechanism in ALK-rearranged NSCLC patients. P-gp exported ceritinib an","ATP Binding Cassette Transporter, Subfamily B, Member 1/antagonists & inhibitors/*genetics/metabolism, Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/pharmacology/therapeutic use, Carcinoma, Non-Small-Cell Lung/diagnosis/drug therapy/*genetics/metabolism, Cell Line, Tumor","Katayama R, Sakashita T, Yanagitani N, Ninomiya H, Horiike A, Friboulet L, Gainor JF, Motoi N, Dobashi A, Sakata S, Tambo Y, Kitazono S, Sato S, Koike S, John Iafrate A, Mino-Kenudson M, Ishikawa Y, Shaw AT, Engelman JA, Takeuchi K, Nishio M, Fujita N","EBioMedicine. 2015 Dec 12;3:54-66. doi","2016 Jan","10.1016/j.ebiom.2015.12.009 [doi], S2352-3964(15)30242-5 [pii]","EBioMedicine"
"98","3860700","A novel Ph1 chromosome positive cell line established from a patient","A novel Philadelphia (Ph1) chromosome positive cell line, designated KYO-1, was established from the peripheral blood of a patient with chronic myelogenous leukemia (CML) in blastic crisis. Although this line had a unique capacity to differentiate spontaneously along the erythroid and monocytoid lineages as evidenced by cytochemical analysis for the first several months, the capacity was gradually lost after repeated passages. The results suggest that KYO-1 is an undifferentiated myeloid cell line. This cell line provides a useful source for studying differentiation and proliferation of pluripotent stem cells from CML in blastic crisis.","Adult, Cell Differentiation, Cell Line, *Chromosomes, Human, 21-22 and Y, Histocytochemistry, Humans, Leukemia, Myeloid/*genetics/immunology/pathology, Male","Ohkubo T, Kamamoto T, Kita K, Hiraoka A, Yoshida Y, Uchino H","Leuk Res. 1985;9(7):921-6. doi","1985","0145-2126(85)90314-5 [pii], 10.1016/0145-2126(85)90314-5 [doi]","Leukemia research"
"99","28002790","Establishment and application of a novel patient-derived KIAA1549:BR","Pilocytic astrocytoma (PA) is the most frequent pediatric brain tumor. Activation of the MAPK pathway is well established as the oncogenic driver of the disease. It is most frequently caused by KIAA1549:BRAF fusions, and leads to oncogene induced senescence (OIS). OIS is thought to be a major reason for growth arrest of PA cells in vitro and in vivo, preventing establishment of PA cultures. Hence, valid preclinical models are currently very limited, but preclinical testing of new compounds is urgently needed. We transduced the PA short-term culture DKFZ-BT66 derived from the PA of a 2-year old patient with a doxycycline-inducible system coding for Simian Vacuolating Virus 40 Large T Antigen (SV40-TAg). SV40-TAg inhibits TP53/CDKN1A and CDKN2A/RB1, two pathways critical for OIS induction and maintenance. DNA methylation array and KIAA1549:BRAF fusion analysis confirmed pilocytic astrocytoma iden","Antigens, Polyomavirus Transforming/genetics, *Astrocytoma, Blotting, Western, *Brain Neoplasms, *Cell Culture Techniques, *Cell Line, Tumor, Cell Proliferation/physiology, Cellular Senescence/*physiology, Child, Preschool, Drug Screening Assays, Antitumor, Gene Expression Profiling,","Selt F, Hohloch J, Hielscher T, Sahm F, Capper D, Korshunov A, Usta D, Brabetz S, Ridinger J, Ecker J, Oehme I, Gronych J, Marquardt V, Pauck D, Bachli H, Stiles CD, von Deimling A, Remke M, Schuhmann MU, Pfister SM, Brummer T, Jones DT, Witt O, Milde T","Oncotarget. 2017 Feb 14;8(7):11460-11479. doi","2017 Feb","14004 [pii], 10.18632/oncotarget.14004 [doi]","Oncotarget"
"100","25349307","Alectinib shows potent antitumor activity against RET-rearranged non","Alectinib/CH5424802 is a known inhibitor of anaplastic lymphoma kinase (ALK) and is being evaluated in clinical trials for the treatment of ALK fusion-positive non-small cell lung cancer (NSCLC). Recently, some RET and ROS1 fusion genes have been implicated as driver oncogenes in NSCLC and have become molecular targets for antitumor agents. This study aims to explore additional target indications of alectinib by testing its ability to inhibit the activity of kinases other than ALK. We newly verified that alectinib inhibited RET kinase activity and the growth of RET fusion-positive cells by suppressing RET phosphorylation. In contrast, alectinib hardly inhibited ROS1 kinase activity unlike other ALK/ROS1 inhibitors such as crizotinib and LDK378. It also showed antitumor activity in mouse models of tumors driven by the RET fusion. In addition, alectinib showed kinase inhibitory activity against R","Animals, Antineoplastic Agents/administration & dosage/chemistry/*pharmacology, Carbazoles/administration & dosage/chemistry/*pharmacology, Carcinoma, Non-Small-Cell Lung/drug therapy/*genetics, Cell Line, Tumor, Cell Proliferation/drug effects, Cytoskeletal Proteins/genetics/metabol","Kodama T, Tsukaguchi T, Satoh Y, Yoshida M, Watanabe Y, Kondoh O, Sakamoto H","Mol Cancer Ther. 2014 Dec;13(12):2910-8. doi","2014 Dec","1535-7163.MCT-14-0274 [pii], 10.1158/1535-7163.MCT-14-0274 [doi]","Molecular cancer therapeutics"
"101","25096400","Hypoxia induces resistance to ALK inhibitors in the H3122 non-small ","Patients with non-small cell lung cancer (NSCLC) with echinoderm microtubule-associated protein-like 4 (EML4)-anaplastic lymphoma kinase (ALK) rearrangements generally respond to ALK inhibitors such as crizotinib. However, some patients with EML4-ALK rearrangements respond poorly to crizotinib. Hypoxia is involved in the resistance to chemotherapeutic treatments in several cancers, and we investigated the association between the responses to ALK inhibitors and hypoxia. Sensitivity of the H3122 NSCLC cell line (EML4-ALK rearrangement) to ALK inhibitors (crizotinib or alectinib) was investigated during a normoxic or hypoxic state using an MTT assay. We found that the cell line was resistant to the inhibitors during hypoxia. Hypoxia mediated morphologic changes, including cell scattering and the elongation of the cell shape, that are characteristic of the epithelial-mesenchymal transition (EMT). A","Anaplastic Lymphoma Kinase, Carcinoma, Non-Small-Cell Lung/*drug therapy/genetics/*pathology, Cell Cycle Proteins/genetics, Cell Hypoxia, Cell Line, Tumor, Cell Proliferation/drug effects, *Drug Resistance, Neoplasm, Epithelial-Mesenchymal Transition, Gene Expression Regulation, Neop","Kogita A, Togashi Y, Hayashi H, Sogabe S, Terashima M, De Velasco MA, Sakai K, Fujita Y, Tomida S, Takeyama Y, Okuno K, Nakagawa K, Nishio K","Int J Oncol. 2014 Oct;45(4):1430-6. doi","2014 Oct","10.3892/ijo.2014.2574 [doi]","International journal of oncology"
"102","24386191","Discovery and preclinical characterization of novel small molecule T","Receptor tyrosine kinases (RTKs), in response to their growth factor ligands, phosphorylate and activate downstream signals important for physiological development and pathological transformation. Increased expression, activating mutations and rearrangement fusions of RTKs lead to cancer, inflammation, pain, neurodegenerative diseases, and other disorders. Activation or over-expression of ALK, ROS1, TRK (A, B, and C), and RET are associated with oncogenic phenotypes of their respective tissues, making them attractive therapeutic targets. Cancer cDNA array studies demonstrated over-expression of TRK-A and ROS1 in a variety of cancers, compared to their respective normal tissue controls. We synthesized a library of small molecules that inhibit the above indicated RTKs with picomolar to nanomolar potency. The lead molecule GTx-186 inhibited RTK-dependent cancer cell and tumor growth. In vitro and ","Animals, Anti-Inflammatory Agents/pharmacology/therapeutic use, Cell Line, Tumor, Dermatitis, Atopic/chemically induced/drug therapy, Disease Models, Animal, Gene Expression, Humans, Inflammation/drug therapy/genetics/*metabolism, Mice, NIH 3T3 Cells, Neoplasms/drug therapy/genetics/","Narayanan R, Yepuru M, Coss CC, Wu Z, Bauler MN, Barrett CM, Mohler ML, Wang Y, Kim J, Snyder LM, He Y, Levy N, Miller DD, Dalton JT","PLoS One. 2013 Dec 26;8(12):e83380. doi","2013","10.1371/journal.pone.0083380 [doi], PONE-D-13-41635 [pii]","PloS one"
"103","28615362","Drugging the catalytically inactive state of RET kinase in RET-rearr","Oncogenic fusion events have been identified in a broad range of tumors. Among them, RET rearrangements represent distinct and potentially druggable targets that are recurrently found in lung adenocarcinomas. We provide further evidence that current anti-RET drugs may not be potent enough to induce durable responses in such tumors. We report that potent inhibitors, such as AD80 or ponatinib, that stably bind in the DFG-out conformation of RET may overcome these limitations and selectively kill RET-rearranged tumors. Using chemical genomics in conjunction with phosphoproteomic analyses in RET-rearranged cells, we identify the CCDC6-RET(I788N) mutation and drug-induced mitogen-activated protein kinase pathway reactivation as possible mechanisms by which tumors may escape the activity of RET inhibitors. Our data provide mechanistic insight into the druggability of RET kinase fusions that may be of","Adenocarcinoma/*metabolism, Adenocarcinoma of Lung, Animals, Cell Line, Tumor, Cytoskeletal Proteins/genetics, Drug Resistance, Neoplasm/genetics, Gene Rearrangement/drug effects/*genetics, Heterocyclic Compounds, 4 or More Rings/pharmacology, Humans, Imidazoles/pharmacology, Lung Ne","Plenker D, Riedel M, Bragelmann J, Dammert MA, Chauhan R, Knowles PP, Lorenz C, Keul M, Buhrmann M, Pagel O, Tischler V, Scheel AH, Schutte D, Song Y, Stark J, Mrugalla F, Alber Y, Richters A, Engel J, Leenders F, Heuckmann JM, Wolf J, Diebold J, Pall G, Peifer M, Aerts M, Gevaert K, Zahedi RP, Buettner R,","Sci Transl Med. 2017 Jun 14;9(394). pii","2017 Jun","9/394/eaah6144 [pii], 10.1126/scitranslmed.aah6144 [doi]","Science translational medicine"
"104","3260522","A Ki-1 (CD30)-positive human cell line (Karpas 299) established from","We describe the characterization of a new human cell line, Karpas 299 (K299), established from blast cells in the peripheral blood of a 25-year-old white man. His illness, which began with enlarged occipital and axillary nodes and weight loss, ended after 7 months with generalized lymphadenopathy, pleural effusion, and bone marrow involvement. A lymph node biopsy showed a large cell lymphoma mainly sinusoidal in distribution. The blast cells with pleomorphic nuclei resembled primitive histiocytes. The cells, which expressed the T-cell-associated markers CD4 and CD5, were positive for HLA-DR, epithelial membrane antigen, and CD30 (Ki-1 antigen). The karyotype was aneuploid and included a translocation 2;5. The site of translocation on chromosome 5 (at 5q35.1) is in the region of the locus of the c-fms oncogene (receptor of the monocyte-macrophage colony-stimulating factor MCSF or CSF-1). The cel","Adult, Antigens, Differentiation, T-Lymphocyte/*analysis/genetics, Cell Line, Chromosome Banding, *Chromosomes, Human, Pair 2, *Chromosomes, Human, Pair 5, Humans, Immunohistochemistry, Karyotyping, Lymphoma, Non-Hodgkin/analysis/genetics/*pathology, Male, Nucleic Acid Hybridization,","Fischer P, Nacheva E, Mason DY, Sherrington PD, Hoyle C, Hayhoe FG, Karpas A","Blood. 1988 Jul;72(1):234-40.","1988 Jul","?","Blood"
"105","27370605","Identification of Existing Drugs That Effectively Target NTRK1 and R","PURPOSE: Efforts to discover drugs that overcome resistance to targeted therapies in patients with rare oncogenic alterations, such as NTRK1 and ROS1 rearrangements, are complicated by the cost and protracted timeline of drug discovery. EXPERIMENTAL DESIGN: In an effort to identify inhibitors of NTRK1 and ROS1, which are aberrantly activated in some patients with non-small cell lung cancer (NSCLC), we created and screened a library of existing targeted drugs against Ba/F3 cells transformed with these oncogenes. RESULTS: This screen identified the FDA-approved drug cabozantinib as a potent inhibitor of CD74-ROS1-transformed Ba/F3, including the crizotinib-resistant mutants G2032R and L2026M (IC50 = 9, 26, and 11 nmol/L, respectively). Cabozantinib inhibited CD74-ROS1-transformed Ba/F3 cells more potently than brigatinib (wild-type/G2032R/L2026M IC50 = 30/170/200 nmol/L, respectively), entrectini","Animals, Antineoplastic Agents/chemistry/*pharmacology, Cell Line, Tumor, *Drug Screening Assays, Antitumor, *Gene Rearrangement, Humans, Lung Neoplasms/diagnosis/drug therapy/*genetics, Mice, Models, Molecular, Molecular Conformation, Molecular Targeted Therapy, Mutation, Phosphoryl","Chong CR, Bahcall M, Capelletti M, Kosaka T, Ercan D, Sim T, Sholl LM, Nishino M, Johnson BE, Gray NS, Janne PA","Clin Cancer Res. 2017 Jan 1;23(1):204-213. doi","2017 Jan","1078-0432.CCR-15-1601 [pii], 10.1158/1078-0432.CCR-15-1601 [doi]","Clinical cancer research"
"106","28500237","Resistance to RET-Inhibition in RET-Rearranged NSCLC Is Mediated By ","Oncogenic rearrangements in RET are present in 1%-2% of lung adenocarcinoma patients. Ponatinib is a multi-kinase inhibitor with low-nanomolar potency against the RET kinase domain. Here, we demonstrate that ponatinib exhibits potent antiproliferative activity in RET fusion-positive LC-2/ad lung adenocarcinoma cells and inhibits phosphorylation of the RET fusion protein and signaling through ERK1/2 and AKT. Using distinct dose escalation strategies, two ponatinib-resistant LC-2/ad cell lines, PR1 and PR2, were derived. PR1 and PR2 cell lines retained expression, but not phosphorylation of the RET fusion and lacked evidence of a resistance mutation in the RET kinase domain. Both resistant lines retained activation of the MAPK pathway. Next-generation RNA sequencing revealed an oncogenic NRAS p.Q61K mutation in the PR1 cell. PR1 cell proliferation was preferentially sensitive to siRNA knockdown o","Carcinoma, Non-Small-Cell Lung/*drug therapy/enzymology/genetics/pathology, Cell Line, Tumor, Cell Proliferation/drug effects, *Drug Resistance, Neoplasm/drug effects/genetics, ErbB Receptors/metabolism, GTP Phosphohydrolases/*metabolism, Gene Rearrangement/*genetics, Humans, Imidazo","Nelson-Taylor SK, Le AT, Yoo M, Schubert L, Mishall KM, Doak A, Varella-Garcia M, Tan AC, Doebele RC","Mol Cancer Ther. 2017 Aug;16(8):1623-1633. doi","2017 Aug","1535-7163.MCT-17-0008 [pii], 10.1158/1535-7163.MCT-17-0008 [doi]","Molecular cancer therapeutics"
"107","29581862","Doxorubicin-induced loss of DNA topoisomerase II and DNMT1- dependen","Systemic anaplastic large-cell lymphoma (ALCL) is a childhood T cell neoplasm defined by the presence or absence of translocations that lead to the ectopic expression of anaplastic lymphoma kinase (ALK), with nucleophosmin-ALK (NPM-ALK) fusions being the most common. Polychemotherapy involving doxorubicin is the standard first-line treatment but for the 25 to 35% of patients who relapse and develop resistance the prognosis remains poor. We studied the potential role of the microRNA miR-125b in the development of resistance to doxorubicin in NPM-ALK(+) ALCL. Our results show that miR-125b expression is repressed in NPM-ALK(+) cell lines and patient samples through hypermethylation of its promoter. NPM-ALK activity, in cooperation with DNA topoisomerase II (Topo II) and DNA methyltransferase 1 (DNMT1), is responsible for miR-125b repression through DNA hypermethylation. MiR-125b repression was re","?","Congras A, Caillet N, Torossian N, Quelen C, Daugrois C, Brousset P, Lamant L, Meggetto F, Hoareau-Aveilla C","Oncotarget. 2018 Feb 8;9(18):14539-14551. doi","2018 Mar","10.18632/oncotarget.24465 [doi], 24465 [pii]","Oncotarget"
"108","27795556","Arsenic trioxide degrades NPM-ALK fusion protein and inhibits growth","?","Arsenic Trioxide, Arsenicals/pharmacology/*therapeutic use, Cell Line, Tumor, Humans, Lymphoma, Large-Cell, Anaplastic/*pathology, Oxides/pharmacology/*therapeutic use, Protein-Tyrosine Kinases/*drug effects/metabolism","Piao W, Chau D, Yue LM, Kwong YL, Tse E","Leukemia. 2017 Feb;31(2):522-526. doi","2017 Feb","leu2016311 [pii], 10.1038/leu.2016.311 [doi]","Leukemia"
"109","28017647","Preclinical approaches in chronic myeloid leukemia","Advances in the design of targeted therapies for the treatment of chronic myeloid leukemia (CML) have transformed the prognosis for patients diagnosed with this disease. However, leukemic stem cell persistence, drug intolerance, drug resistance, and advanced-phase disease represent unmet clinical needs demanding the attention of CML investigators worldwide. The availability of appropriate preclinical models is essential to efficiently translate findings from the bench to the clinic. Here we review the current approaches taken to preclinical work in the CML field, including examples of commonly used in vivo models and recent successes from systems biology-based methodologies.","Animals, Animals, Genetically Modified, Cell Line, Transformed, Cell Transplantation, Disease Models, Animal, Drug Evaluation, Preclinical, Humans, In Vitro Techniques, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/etiology/pathology/*therapy, Transduction, Genetic, Transgenes, Tu","Clarke CJ, Holyoake TL","Exp Hematol. 2017 Mar;47:13-23. doi","2017 Mar","S0301-472X(16)30750-0 [pii], 10.1016/j.exphem.2016.11.005 [doi]","Experimental hematology"
"110","2223646","The role of alternative splicing patterns of BCR/ABL transcripts in ","Three major types of mRNA can be expressed as a result of the Philadelphia translocation, dependent on the position of the break within the BCR gene on chromosome 22. In addition, alternative splicing of the mRNA transcribed from the BCR/ABL fusion gene has been reported and it has been suggested that this may play a role in the generation of the acute phase of Philadelphia positive chronic myeloid leukaemia (CML). We have examined the fusion RNA present in 24 cases of chronic phase CML and 21 cases of patients with CML in blast crisis using the polymerase chain reaction. In no case was it possible to detect the presence of the e1a2 junction which encodes the p190 hybrid protein product. We conclude that the acquisition of the p190 does not play a significant role in the generation of the blast crisis of CML. Neither could we detect a significant difference in the number of cases which simultan","Base Sequence, Blast Crisis/*genetics, Electrophoresis, Agar Gel, Fusion Proteins, bcr-abl/*genetics, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics, Molecular Sequence Data, Polymerase Chain Reaction, RNA Splicing/*physiology, RNA, Messenger/analysis, Transcripti","Morgan GJ, Hernandez A, Chan LC, Hughes T, Martiat P, Wiedemann LM","Br J Haematol. 1990 Sep;76(1):33-8. doi","1990 Sep","10.1111/j.1365-2141.1990.tb07833.x [doi]","British journal of haematology"
"111","25926053","The molecular landscape of colorectal cancer cell lines unveils clin","The development of molecularly targeted anticancer agents relies on large panels of tumour-specific preclinical models closely recapitulating the molecular heterogeneity observed in patients. Here we describe the mutational and gene expression analyses of 151 colorectal cancer (CRC) cell lines. We find that the whole spectrum of CRC molecular and transcriptional subtypes, previously defined in patients, is represented in this cell line compendium. Transcriptional outlier analysis identifies RAS/BRAF wild-type cells, resistant to EGFR blockade, functionally and pharmacologically addicted to kinase genes including ALK, FGFR2, NTRK1/2 and RET. The same genes are present as expression outliers in CRC patient samples. Genomic rearrangements (translocations) involving the ALK and NTRK1 genes are associated with the overexpression of the corresponding proteins in CRC specimens. The approach described ","Anaplastic Lymphoma Kinase, Cell Line, Tumor, Cetuximab, Colorectal Neoplasms/*enzymology/genetics, ErbB Receptors/*antagonists & inhibitors, Genes, erbB-1, Genetic Heterogeneity, Humans, Molecular Targeted Therapy, Proto-Oncogene Proteins c-ret/metabolism, Receptor Protein-Tyrosine ","Medico E, Russo M, Picco G, Cancelliere C, Valtorta E, Corti G, Buscarino M, Isella C, Lamba S, Martinoglio B, Veronese S, Siena S, Sartore-Bianchi A, Beccuti M, Mottolese M, Linnebacher M, Cordero F, Di Nicolantonio F, Bardelli A","Nat Commun. 2015 Apr 30;6:7002. doi","2015 Apr","ncomms8002 [pii], 10.1038/ncomms8002 [doi]","Nature communications"
"112","15361874","Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymph","In T-cell acute lymphoblastic leukemia (T-ALL), transcription factors are known to be deregulated by chromosomal translocations, but mutations in protein tyrosine kinases have only rarely been identified. Here we describe the extrachromosomal (episomal) amplification of ABL1 in 5 of 90 (5.6%) individuals with T-ALL, an aberration that is not detectable by conventional cytogenetics. Molecular analyses delineated the amplicon as a 500-kb region from chromosome band 9q34, containing the oncogenes ABL1 and NUP214 (refs. 5,6). We identified a previously undescribed mechanism for activation of tyrosine kinases in cancer: the formation of episomes resulting in a fusion between NUP214 and ABL1. We detected the NUP214-ABL1 transcript in five individuals with the ABL1 amplification, in 5 of 85 (5.8%) additional individuals with T-ALL and in 3 of 22 T-ALL cell lines. The constitutively phosphorylated tyro","Amino Acid Sequence, Artificial Gene Fusion, Base Sequence, Benzamides, Cell Line, Tumor, Chromosomes, Human, Pair 9/genetics, DNA, Neoplasm/genetics, Enzyme Inhibitors/therapeutic use, Gene Amplification, *Genes, abl, Humans, Imatinib Mesylate, In Situ Hybridization, Fluorescence, L","Graux C, Cools J, Melotte C, Quentmeier H, Ferrando A, Levine R, Vermeesch JR, Stul M, Dutta B, Boeckx N, Bosly A, Heimann P, Uyttebroeck A, Mentens N, Somers R, MacLeod RA, Drexler HG, Look AT, Gilliland DG, Michaux L, Vandenberghe P, Wlodarska I, Marynen P, Hagemeijer A","Nat Genet. 2004 Oct;36(10):1084-9. doi","2004 Oct","10.1038/ng1425 [doi], ng1425 [pii]","Nature genetics"
"113","25997600","Dissecting the role of aberrant DNA methylation in human leukaemia.","Chronic myeloid leukaemia (CML) is a myeloproliferative disorder characterized by the genetic translocation t(9;22)(q34;q11.2) encoding for the BCR-ABL fusion oncogene. However, many molecular mechanisms of the disease progression still remain poorly understood. A growing body of evidence suggests that the epigenetic abnormalities are involved in tyrosine kinase resistance in CML, leading to leukaemic clone escape and disease propagation. Here we show that, by applying cellular reprogramming to primary CML cells, aberrant DNA methylation contributes to the disease evolution. Importantly, using a BCR-ABL inducible murine model, we demonstrate that a single oncogenic lesion triggers DNA methylation changes, which in turn act as a precipitating event in leukaemia progression.","Animals, Azacitidine, Cell Differentiation, Cellular Reprogramming Techniques, *DNA Methylation, *Genes, abl, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics, Mice, Transgenic, U937 Cells","Amabile G, Di Ruscio A, Muller F, Welner RS, Yang H, Ebralidze AK, Zhang H, Levantini E, Qi L, Martinelli G, Brummelkamp T, Le Beau MM, Figueroa ME, Bock C, Tenen DG","Nat Commun. 2015 May 22;6:7091. doi","2015 May","ncomms8091 [pii], 10.1038/ncomms8091 [doi]","Nature communications"
"114","25581823","In vivo imaging models of bone and brain metastases and pleural carc","EML4-ALK lung cancer accounts for approximately 3-7% of non-small-cell lung cancer cases. To investigate the molecular mechanism underlying tumor progression and targeted drug sensitivity/resistance in EML4-ALK lung cancer, clinically relevant animal models are indispensable. In this study, we found that the lung adenocarcinoma cell line A925L expresses an EML4-ALK gene fusion (variant 5a, E2:A20) and is sensitive to the ALK inhibitors crizotinib and alectinib. We further established highly tumorigenic A925LPE3 cells, which also have the EML4-ALK gene fusion (variant 5a) and are sensitive to ALK inhibitors. By using A925LPE3 cells with luciferase gene transfection, we established in vivo imaging models for pleural carcinomatosis, bone metastasis, and brain metastasis, all of which are significant clinical concerns of advanced EML4-ALK lung cancer. Interestingly, crizotinib caused tumors to shri","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/pharmacology, Bone Neoplasms/*diagnostic imaging/drug therapy/secondary, Brain Neoplasms/*diagnostic imaging/drug therapy/secondary, Carbazoles/pharmacology, Carcinoma, Non-Small-Cell Lung/*genetics, Cell Cycle Proteins/*gene","Nanjo S, Nakagawa T, Takeuchi S, Kita K, Fukuda K, Nakada M, Uehara H, Nishihara H, Hara E, Uramoto H, Tanaka F, Yano S","Cancer Sci. 2015 Mar;106(3):244-52. doi","2015 Mar","10.1111/cas.12600 [doi]","Cancer science"
"115","24349524","Inhibition of PI3K/mTOR overcomes nilotinib resistance in BCR-ABL1 p","Chronic myeloid leukemia (CML) is a cytogenetic disorder resulting from formation of the Philadelphia chromosome (Ph), that is, the t(9;22) chromosomal translocation and the formation of the BCR-ABL1 fusion protein. Tyrosine kinase inhibitors (TKI), such as imatinib and nilotinib, have emerged as leading compounds with which to treat CML. t(9;22) is not restricted to CML, 20-30% of acute lymphoblastic leukemia (ALL) cases also carry the Ph. However, TKIs are not as effective in the treatment of Ph+ ALL as in CML. In this study, the Ph+ cell lines JURL-MK2 and SUP-B15 were used to investigate TKI resistance mechanisms and the sensitization of Ph+ tumor cells to TKI treatment. The annexin V/PI (propidium iodide) assay revealed that nilotinib induced apoptosis in JURL-MK2 cells, but not in SUP-B15 cells. Since there was no mutation in the tyrosine kinase domain of BCR-ABL1 in cell line SUP-B15, th","Cell Line, Tumor, Down-Regulation/drug effects, Drug Resistance, Neoplasm/*drug effects, *Fusion Proteins, bcr-abl, Gene Expression Regulation, Leukemic/*drug effects, Humans, Imidazoles/*pharmacology, Leukemia/*drug therapy/genetics/metabolism, Phosphatidylinositol 3-Kinases/genetic","Ding J, Romani J, Zaborski M, MacLeod RA, Nagel S, Drexler HG, Quentmeier H","PLoS One. 2013 Dec 11;8(12):e83510. doi","2013","10.1371/journal.pone.0083510 [doi], PONE-D-13-32538 [pii]","PloS one"
"116","27119231","Oncogenic ALK regulates EMT in non-small cell lung carcinoma through","A subset of Non-Small Cell Lung Carcinoma (NSCLC) carries chromosomal rearrangements involving the Anaplastic Lymphoma Kinase (ALK) gene. ALK-rearranged NSCLC are typically adenocarcinoma characterized by a solid signet-ring cell pattern that is frequently associated with a metastatic phenotype. Recent reports linked the presence of ALK rearrangement to an epithelial-mesenchymal transition (EMT) phenotype in NSCLC, but the extent and the mechanisms of an ALK-mediated EMT in ALK-rearranged NSCLC are largely unknown. We found that the ALK-rearranged H2228 and DFCI032, but not the H3122, cell lines displayed a mesenchymal phenotype. In these cell lines, oncogenic ALK activity dictated an EMT phenotype by directly suppressing E-cadherin and up-regulating vimentin expression, as well as expression of other genes involved in EMT. We found that the epithelial splicing regulatory protein 1 (ESRP1), a k","Anaplastic Lymphoma Kinase, Animals, Antigens, CD, Antineoplastic Agents/pharmacology, Biomarkers, Tumor/genetics/*metabolism, Cadherins/genetics/metabolism, Carcinoma, Non-Small-Cell Lung/drug therapy/*enzymology/genetics/pathology, Cell Cycle Proteins/genetics/metabolism, Cell Line","Voena C, Varesio LM, Zhang L, Menotti M, Poggio T, Panizza E, Wang Q, Minero VG, Fagoonee S, Compagno M, Altruda F, Monti S, Chiarle R","Oncotarget. 2016 May 31;7(22):33316-30. doi","2016 May","8955 [pii], 10.18632/oncotarget.8955 [doi]","Oncotarget"
"117","24853389","ALK-positive non-small cell lung cancer","Targeted therapy has emerged as an effective treatment option for certain molecular subsets of advanced stage non-small cell lung cancer (NSCLC). The discovery of the echinoderm microtubule-associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) translocation as an oncogenic driver has led to the development of novel therapies with activity in vitro and in the clinic. The first-in-class tyrosine kinase inhibitor crizotinib is effective against ALK-positive NSCLC and is currently used as first-line or salvage therapy in the setting of advanced disease. However, resistance inevitably develops through a variety of mechanisms, including point mutations affecting the fusion protein, activation of bypass signaling pathways, copy number gain of ALK, and other means. Increased understanding of these pathways is essential for tailoring treatment choices to improve outcomes and minimize toxicitie","Anaplastic Lymphoma Kinase, Animals, Carcinoma, Non-Small-Cell Lung/*drug therapy/*enzymology/pathology, Drug Resistance, Neoplasm, Humans, Lung Neoplasms/*drug therapy/*enzymology/pathology, Receptor Protein-Tyrosine Kinases/*metabolism","Steuer CE, Ramalingam SS","Cancer. 2014 Aug 15;120(16):2392-402. doi","2014 Aug","10.1002/cncr.28597 [doi]","Cancer"
"118","7693103","BCR/ABL oncoprotein-targeted antitumor activity of antisense oligode","We investigated whether antisense oligodeoxynucleotides complementary to bcr/abl mRNA or protein kinase antagonists display antitumor activity on Ph1-positive leukemia cell lines. bcr/abl antisense oligomers showed inhibitory effects on the in vitro growth of Ph1-positive leukemia cell lines in liquid culture, and further displayed an inhibitory effect on transformed murine hematopoietic cells using transfection with a retroviral vector expressing P210bcr/abl oncoprotein. However, in vitro treatment with a bcr/abl antisense oligomer did not completely abolish the expression of bcr/abl mRNA and did not display the desired ""killing effect"" on Ph1-positive leukemia cells. On the other hand, investigation of the effect on Ph1-positive leukemia cells by various types of protein kinase antagonists revealed that herbimycin A, a protein tyrosine kinase antagonist, displays preferential and remarkable s","Antibiotics, Antineoplastic/pharmacology/*therapeutic use, Base Sequence, Benzoquinones, Cell Division/drug effects, DNA, Antisense/*therapeutic use, Dose-Response Relationship, Drug, Fusion Proteins, bcr-abl/*antagonists & inhibitors/genetics, Humans, Lactams, Macrocyclic, Leukemia,","Okabe M, Kunieda Y, Miyagishima T, Kobayashi M, Kurosawa M, Itaya T, Sakurada K, Miyazaki T","Leuk Lymphoma. 1993 Jul;10(4-5):307-16. doi","1993 Jul","10.3109/10428199309148553 [doi]","Leukemia & lymphoma"
"119","23154560","Identification of CCDC6-RET fusion in the human lung adenocarcinoma ","Rearranged during transfection (RET) fusions have been newly identified in approximately 1% of patients with primary lung tumors. However, patient-derived lung cancer cell lines harboring RET fusions have not yet been established or identified, and therefore, the effectiveness of an RET inhibitor on lung tumors with endogenous RET fusion has not yet been studied. In this study, we report identification of CCDC6-RET fusion in the human lung adenocarcinoma cell line LC-2/ad. LC-2/ad showed distinctive sensitivity to the RET inhibitor, vandetanib, among 39 non-small lung cancer cell lines. The xenograft tumor of LC-2/ad showed cribriform acinar structures, a morphologic feature of primary RET fusion-positive lung adenocarcinomas. LC-2/ad cells could provide useful resources to analyze molecular functions of RET-fusion protein and its response to RET inhibitors.","Adenocarcinoma/drug therapy/*genetics/pathology, Animals, Antineoplastic Combined Chemotherapy Protocols/pharmacology, Blotting, Western, Carcinoma, Non-Small-Cell Lung/drug therapy/*genetics/pathology, Cell Proliferation/drug effects, Cytoskeletal Proteins/*genetics, Female, Gefitin","Matsubara D, Kanai Y, Ishikawa S, Ohara S, Yoshimoto T, Sakatani T, Oguni S, Tamura T, Kataoka H, Endo S, Murakami Y, Aburatani H, Fukayama M, Niki T","J Thorac Oncol. 2012 Dec;7(12):1872-1876. doi","2012 Dec","10.1097/JTO.0b013e3182721ed1 [doi], S1556-0864(15)33173-7 [pii]","Journal of thoracic oncology"
"120","12506034","TNF-related apoptosis-inducing ligand (TRAIL) frequently induces apo","Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) and Fas ligand (FasL) have been implicated in antitumor immunity and therapy. In the present study, we investigated the sensitivity of Philadelphia chromosome (Ph1)-positive leukemia cell lines to TRAIL- or FasL-induced cell death to explore the possible contribution of these molecules to immunotherapy against Ph1-positive leukemias. TRAIL, but not FasL, effectively induced apoptotic cell death in most of 5 chronic myelogenous leukemia-derived and 7 acute leukemia-derived Ph1-positive cell lines. The sensitivity to TRAIL was correlated with cell-surface expression of death-inducing receptors DR4 and/or DR5. The TRAIL-induced cell death was caspase-dependent and enhanced by nuclear factor kappa B inhibitors. Moreover, primary leukemia cells from Ph1-positive acute lymphoblastic leukemia patients were also sensitive to TRAIL, b","Amino Acid Chloromethyl Ketones/pharmacology, Apoptosis/*drug effects, Apoptosis Regulatory Proteins, *Arabidopsis Proteins, Benzamides, CASP8 and FADD-Like Apoptosis Regulating Protein, Carrier Proteins/physiology, Caspase 1/physiology, Death Domain Receptor Signaling Adaptor Protei","Uno K, Inukai T, Kayagaki N, Goi K, Sato H, Nemoto A, Takahashi K, Kagami K, Yamaguchi N, Yagita H, Okumura K, Koyama-Okazaki T, Suzuki T, Sugita K, Nakazawa S","Blood. 2003 May 1;101(9):3658-67. doi","2003 May","10.1182/blood-2002-06-1770 [doi], 2002-06-1770 [pii]","Blood"
"121","18656692","Establishment and cytogenetic characterization of a human acute lymp","Fusion kinases (FK) like BCR/ABL1 mediate leukemic transformation and represent therapeutic targets. Fusion of ETV6 (ETS translocation variant 6, previously known as TEL) to ABL1 due to t(9;12) has been observed in various hematological malignancies. ETV6/ABL1 and BCR/ABL1 FK display similar activity but they may not be identical in function. Here we present the generation of an ETV6/ABL1 positive human acute lymphoblastic leukemia (ALL) cell line, ALL-VG. The cell line expressed ETV6/ABL1 fusion transcripts and displayed sensitivity to imatinib with an IC(50) of 0.1 microM. Karyotyping did not reveal overt t(9;12), suggesting a cryptic translocation. Fluorescent in situ hybridization and array-based comparative genomic hybridization were performed to characterize the rearrangement. ETV6/ABL1 fusion was demonstrated to result from insertion of a duplicated 300 to 1300 kb region of 9q34 that con","Adult, Benzamides, *Cell Line, Tumor, Cell Survival/drug effects, Chromosome Deletion, Chromosomes, Human, Pair 1, Chromosomes, Human, Pair 12, *Chromosomes, Human, Pair 6, Cytogenetic Analysis, Dose-Response Relationship, Drug, *Genes, abl, Humans, Imatinib Mesylate, Inhibitory Conc","Baeumler J, Szuhai K, Falkenburg JH, van Schie ML, Ottmann OG, Nijmeijer BA","Cancer Genet Cytogenet. 2008 Aug;185(1):37-42. doi","2008 Aug","S0165-4608(08)00278-1 [pii], 10.1016/j.cancergencyto.2008.05.001 [doi]","Cancer genetics and cytogenetics"
"122","24836440","BCR-ABL affects STAT5A and STAT5B differentially.","Signal transducers and activators of transcription (STATs) are latent cytoplasmic transcription factors linking extracellular signals to target gene transcription. Hematopoietic cells express two highly conserved STAT5-isoforms (STAT5A/STAT5B), and STAT5 is directly activated by JAK2 downstream of several cytokine receptors and the oncogenic BCR-ABL tyrosine kinase. Using an IL-3-dependent cell line with inducible BCR-ABL-expression we compared STAT5-activation by IL-3 and BCR-ABL in a STAT5-isoform specific manner. RNAi targeting of STAT5B strongly inhibits BCR-ABL-dependent cell proliferation, and STAT5B but not STAT5A is essential for BCL-XL-expression in the presence of BCR-ABL. Although BCR-ABL induces STAT5-tyrosine phosphorylation independent of JAK2-kinase activity, BCR-ABL is less efficient in inducing active STAT5A:STAT5B-heterodimerization than IL-3, leaving constitutive STAT5A and S","Benzamides, Cell Line, Cell Proliferation/physiology, Dimerization, Fluorescent Antibody Technique, Fusion Proteins, bcr-abl/*metabolism, Genetic Vectors/genetics, Humans, Imatinib Mesylate, Immunoblotting, Immunoprecipitation, Interleukin-3/metabolism, Lentivirus, Mass Spectrometry,","Schaller-Schonitz M, Barzan D, Williamson AJ, Griffiths JR, Dallmann I, Battmer K, Ganser A, Whetton AD, Scherr M, Eder M","PLoS One. 2014 May 16;9(5):e97243. doi","2014","10.1371/journal.pone.0097243 [doi], PONE-D-13-49252 [pii]","PloS one"
"123","25170107","A new human lung adenocarcinoma cell line harboring the EML4-ALK fus","OBJECTIVE: The echinoderm microtubule associated protein-like 4 (EML4)-anaplastic lymphoma kinase (ALK) fusion gene was identified in patients with non-small cell lung cancer. To the best of our knowledge, there are only three cell lines harboring the EML4-ALK fusion gene, which have contributed to the development of therapeutic strategies. Therefore, we tried to establish a new lung cancer cell line harboring EML4-ALK. METHODS: A 61-year-old Japanese female presented with chest discomfort. She was diagnosed with left lung adenocarcinoma with T4N3M1 Stage IV. Although she was treated with chemotherapy, her disease progressed with massive pleural effusion. Because the EML4-ALK rearrangement was found in a biopsied specimen using fluorescence in situ hybridization, she was treated with crizotinib. She did well for 3 months. RESULTS: Tumor cells were obtained from the malignant pleural effusion be","*Adenocarcinoma/drug therapy/genetics, Adenocarcinoma of Lung, Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/*pharmacology, Cell Cycle Proteins/*genetics, Cell Line, Tumor, Crizotinib, Female, Humans, Immunohistochemistry, In Situ Hybridization, Fluorescence, *Lung Neopl","Isozaki H, Yasugi M, Takigawa N, Hotta K, Ichihara E, Taniguchi A, Toyooka S, Hashida S, Sendo T, Tanimoto M, Kiura K","Jpn J Clin Oncol. 2014 Oct;44(10):963-8. doi","2014 Oct","hyu110 [pii], 10.1093/jjco/hyu110 [doi]","Japanese journal of clinical oncology"
"124","24419060","The selective anaplastic lymphoma receptor tyrosine kinase inhibitor","Activation of anaplastic lymphoma receptor tyrosine kinase (ALK) is involved in the pathogenesis of several carcinomas, including non-small cell lung cancer (NSCLC). Echinoderm microtubule-associated protein like 4 (EML4)-ALK, which is derived from the rearrangement of ALK and EML4 genes, has been validated as a therapeutic target in a subset of patients with NSCLC. Here, we investigated the effects of ASP3026, a novel small-molecule ALK inhibitor, against ALK-driven NSCLC. ASP3026 inhibited ALK activity in an ATP-competitive manner and had an inhibitory spectrum that differed from that of crizotinib, a dual ALK/MET inhibitor. In mice xenografted with NCI-H2228 cells expressing EML4-ALK, orally administered ASP3026 was well absorbed in tumor tissues, reaching concentrations >10-fold higher than those in plasma, and induced tumor regression with a wide therapeutic margin between efficacious and ","3T3 Cells, Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/pharmacology, Carcinoma, Non-Small-Cell Lung/*drug therapy/genetics/metabolism, Cell Proliferation/drug effects, Cell Survival/drug effects, Drug Synergism, Glutamates/pharmacology, Guanine/analogs & derivatives/ph","Mori M, Ueno Y, Konagai S, Fushiki H, Shimada I, Kondoh Y, Saito R, Mori K, Shindou N, Soga T, Sakagami H, Furutani T, Doihara H, Kudoh M, Kuromitsu S","Mol Cancer Ther. 2014 Feb;13(2):329-40. doi","2014 Feb","1535-7163.MCT-13-0395 [pii], 10.1158/1535-7163.MCT-13-0395 [doi]","Molecular cancer therapeutics"
"125","28557340","TrkA is a binding partner of NPM-ALK that promotes the survival of A","Nucleophosmin-anaplastic lymphoma kinase-expressing (NPM-ALK(+) ) T-cell lymphoma is an aggressive neoplasm that is more commonly seen in children and young adults. The pathogenesis of NPM-ALK(+) T-cell lymphoma is not completely understood. Wild-type ALK is a receptor tyrosine kinase that is physiologically expressed in neural tissues during early stages of human development, which suggests that ALK may interact with neurotrophic factors. The aberrant expression of NPM-ALK results from a translocation between the ALK gene on chromosome 2p23 and the NPM gene on chromosome 5q35. The nerve growth factor (NGF) is the first neurotrophic factor attributed to non-neural functions including cancer cell survival, proliferation, and metastasis. These functions are primarily mediated through the tropomyosin receptor kinase A (TrkA). The expression and role of NGF/TrkA in NPM-ALK(+) T-cell lymphoma are no","Anaplastic Lymphoma Kinase, Animals, Cell Line, Tumor, Cell Proliferation/drug effects, Cell Survival/drug effects, Down-Regulation/drug effects, Humans, Lymphoma, T-Cell/*metabolism/*pathology, Mice, Mice, SCID, Nerve Growth Factor/metabolism, Phosphorylation/drug effects, Protein B","Shi W, George SK, George B, Curry CV, Murzabdillaeva A, Alkan S, Amin HM","Mol Oncol. 2017 Sep;11(9):1189-1207. doi","2017 Sep","10.1002/1878-0261.12088 [doi]","Molecular oncology"
"126","28556300","Development of protein degradation inducers of oncogenic BCR-ABL pro","Chromosomal translocation occurs in some cancer cells, which results in the expression of aberrant oncogenic fusion proteins that include BCR-ABL in chronic myelogenous leukemia (CML). Inhibitors of ABL tyrosine kinase, such as imatinib and dasatinib, exhibit remarkable therapeutic effects, although emergence of drug resistance hampers the therapy during long-term treatment. An alternative approach to treat CML is to downregulate the BCR-ABL protein. We have devised a protein knockdown system by hybrid molecules named Specific and Non-genetic inhibitor of apoptosis protein [IAP]-dependent Protein Erasers (SNIPER), which is designed to induce IAP-mediated ubiquitylation and proteasomal degradation of target proteins, and a couple of SNIPER(ABL) against BCR-ABL protein have been developed recently. In this study, we tested various combinations of ABL inhibitors and IAP ligands, and the linker was","Cell Line, Tumor, Cell Proliferation/drug effects, Cell Survival/drug effects, Dasatinib/chemistry/*pharmacology, Down-Regulation, Fusion Proteins, bcr-abl/*metabolism, Gene Expression Regulation, Neoplastic/drug effects, Humans, Inhibitor of Apoptosis Proteins/*metabolism, K562 Cell","Shibata N, Miyamoto N, Nagai K, Shimokawa K, Sameshima T, Ohoka N, Hattori T, Imaeda Y, Nara H, Cho N, Naito M","Cancer Sci. 2017 Aug;108(8):1657-1666. doi","2017 Aug","10.1111/cas.13284 [doi]","Cancer science"
"127","29655153","New rapid method to detect BCR-ABL fusion genes with multiplex RT-qP","Fast identification of BCR-ABL fusion genes is critical for precise diagnosis, risk stratification and therapy scheme selection in leukemia. More convenient methods are needed for quickly detection of the BCR-ABL fusion genes. Multiplex fluorescent reverse transcription quantitative real-time PCR (Multiplex RT-qPCR) methods are developed for detection of the at least 14 subtypes of BCR-ABL fusion genes in one tube at a time by using patients' bone marrow samples. The new Multiplex RT-qPCR method could quickly detect BCR-ABL fusion genes with sensitivity up to 10-10(6) copies. It can detect the fusion genes in patients' bone marrow samples containing any subtypes of the major bcr (M-bcr) e13a2, e14a2, e13a3 and e14a3, the minor bcr (m-bcr) e1a2 and e1a3, the micro bcr (mu-bcr) e19a2 and e19a3, and the nano bcr (n-bcr) e6a2 and e6a3. The specificity is comparable to the FISH methods. The cutoff f","Cell Line, Tumor, Fusion Proteins, bcr-abl/*genetics, Humans, In Situ Hybridization, Fluorescence, Multiplex Polymerase Chain Reaction/*methods","Tong YQ, Zhao ZJ, Liu B, Bao AY, Zheng HY, Gu J, Xia Y, McGrath M, Dovat S, Song CH, Li Y","Leuk Res. 2018 Jun;69:47-53. doi","2018 Jun","S0145-2126(18)30079-1 [pii], 10.1016/j.leukres.2018.04.001 [doi]","Leukemia research"
"128","26689674","Novel kinase fusion transcripts found in endometrial cancer.","Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but no","Alleles, Amino Acid Sequence, Base Sequence, Cell Line, Tumor, DNA Copy Number Variations/genetics, Endometrial Neoplasms/*genetics, Female, Gene Knockdown Techniques, Humans, Molecular Sequence Data, Oncogene Proteins, Fusion/chemistry/*genetics/metabolism, Protein Kinases/*metaboli","Tamura R, Yoshihara K, Yamawaki K, Suda K, Ishiguro T, Adachi S, Okuda S, Inoue I, Verhaak RG, Enomoto T","Sci Rep. 2015 Dec 22;5:18657. doi","2015 Dec","srep18657 [pii], 10.1038/srep18657 [doi]","Scientific reports"
"129","28428274","EGFR Mediates Responses to Small-Molecule Drugs Targeting Oncogenic ","Oncogenic kinase fusions of ALK, ROS1, RET, and NTRK1 act as drivers in human lung and other cancers. Residual tumor burden following treatment of ALK or ROS1(+) lung cancer patients with oncogene-targeted therapy ultimately enables the emergence of drug-resistant clones, limiting the long-term effectiveness of these therapies. To determine the signaling mechanisms underlying incomplete tumor cell killing in oncogene-addicted cancer cells, we investigated the role of EGFR signaling in drug-naive cancer cells harboring these oncogene fusions. We defined three distinct roles for EGFR in the response to oncogene-specific therapies. First, EGF-mediated activation of EGFR blunted fusion kinase inhibitor binding and restored fusion kinase signaling complexes. Second, fusion kinase inhibition shifted adaptor protein binding from the fusion oncoprotein to EGFR. Third, EGFR enabled bypass signaling to c","Animals, Carcinoma, Non-Small-Cell Lung/*drug therapy/*enzymology/genetics/pathology, Cell Line, Tumor, Cell Proliferation/drug effects, ErbB Receptors/antagonists & inhibitors/genetics/*metabolism, HEK293 Cells, Humans, Lung Neoplasms/*drug therapy/*enzymology/genetics/pathology, Ma","Vaishnavi A, Schubert L, Rix U, Marek LA, Le AT, Keysar SB, Glogowska MJ, Smith MA, Kako S, Sumi NJ, Davies KD, Ware KE, Varella-Garcia M, Haura EB, Jimeno A, Heasley LE, Aisner DL, Doebele RC","Cancer Res. 2017 Jul 1;77(13):3551-3563. doi","2017 Jul","0008-5472.CAN-17-0109 [pii], 10.1158/0008-5472.CAN-17-0109 [doi]","Cancer research"
"130","19147828","EML4-ALK rearrangement in non-small cell lung cancer and non-tumor l","A fusion gene, echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK), with transforming activity has recently been identified in a subset of non-small cell lung cancer (NSCLC), but its pathogenetic, diagnostic, and therapeutic roles remain unclear. Both frequency and type of EML4-ALK transcripts were investigated by reverse transcription PCR in 120 frozen NSCLC specimens from Italy and Spain; non-neoplastic lung tissues taken far from the tumor were used as controls. In cases carrying the fusion transcript, we determined EML4-ALK gene and protein levels using fluorescence in situ hybridization, Western blotting, and immunoprecipitation. We also analyzed ALK protein levels in paraffin samples from 662 NSCLC specimens, including the 120 cases investigated in the molecular studies. EML4-ALK transcripts (variants 1 and 3) were detected in 9 of 120 NSCLC samples but ","Aged, Aged, 80 and over, Biomarkers, Tumor/analysis, Blotting, Western, Carcinoma, Non-Small-Cell Lung/*genetics/metabolism, Female, Gene Rearrangement, Humans, Immunohistochemistry, Immunoprecipitation, In Situ Hybridization, Fluorescence, Lung/metabolism, Lung Neoplasms/*genetics/m","Martelli MP, Sozzi G, Hernandez L, Pettirossi V, Navarro A, Conte D, Gasparini P, Perrone F, Modena P, Pastorino U, Carbone A, Fabbri A, Sidoni A, Nakamura S, Gambacorta M, Fernandez PL, Ramirez J, Chan JK, Grigioni WF, Campo E, Pileri SA, Falini B","Am J Pathol. 2009 Feb;174(2):661-70. doi","2009 Feb","S0002-9440(10)61323-5 [pii], 10.2353/ajpath.2009.080755 [doi]","The American journal of pathology"
"131","10910924","Selection and characterization of BCR-ABL positive cell lines with d","Targeting the tyrosine kinase activity of Bcr-Abl with STI571 is an attractive therapeutic strategy in chronic myelogenous leukemia (CML). A few CML cell lines and primary progenitors are, however, resistant to this compound. We investigated the mechanism of this resistance in clones of the murine BaF/3 cells transfected with BCR-ABL and in 4 human cell lines from which sensitive (s) and resistant (r) clones were generated by various methods. Although the resistant cells were able to survive in the presence of STI571, their proliferation was approximately 30% lower than that of their sensitive counterparts in the absence of the compound. The concentration of STI571 needed for a 50% reduction in viable cells after a 3-day exposure was on average 10 times higher in the resistant (2-3 micromol/L) than in the sensitive (0.2-0.25 micromol/L) clones. The mechanism of resistance to STI571 varied among","Antineoplastic Agents/*pharmacology, Benzamides, *Drug Resistance, Neoplasm, Fusion Proteins, bcr-abl/*biosynthesis, Humans, Imatinib Mesylate, Piperazines/*pharmacology, Pyrimidines/*pharmacology, *Tumor Cells, Cultured","Mahon FX, Deininger MW, Schultheis B, Chabrol J, Reiffers J, Goldman JM, Melo JV","Blood. 2000 Aug 1;96(3):1070-9.","2000 Aug","?","Blood"
"132","25978431","NPM-ALK mediates phosphorylation of MSH2 at tyrosine 238, creating a","The vast majority of anaplastic lymphoma kinase-positive anaplastic large cell lymphoma (ALK+ALCL) tumors express the characteristic oncogenic fusion protein NPM-ALK, which mediates tumorigenesis by exerting its constitutive tyrosine kinase activity on various substrates. We recently identified MSH2, a protein central to DNA mismatch repair (MMR), as a novel binding partner and phosphorylation substrate of NPM-ALK. Here, using liquid chromatography-mass spectrometry, we report for the first time that MSH2 is phosphorylated by NPM-ALK at a specific residue, tyrosine 238. Using GP293 cells transfected with NPM-ALK, we confirmed that the MSH2(Y238F) mutant is not tyrosine phosphorylated. Furthermore, transfection of MSH2(Y238F) into these cells substantially decreased the tyrosine phosphorylation of endogenous MSH2. Importantly, gene transfection of MSH2(Y238F) abrogated the binding of NPM-ALK wit","Anaplastic Lymphoma Kinase, Blotting, Western, Cell Line, Tumor, Chromatography, Liquid, DNA Mismatch Repair/*physiology, Humans, Immunoprecipitation, Lymphoma, Large-Cell, Anaplastic/*metabolism/pathology, Mass Spectrometry, MutS Homolog 2 Protein/*metabolism, Mutagenesis, Site-Dire","Bone KM, Wang P, Wu F, Wu C, Li L, Bacani JT, Andrew SE, Lai R","Blood Cancer J. 2015 May 15;5:e311. doi","2015 May","bcj201535 [pii], 10.1038/bcj.2015.35 [doi]","Blood cancer journal"
"133","14630792","The EOL-1 cell line as an in vitro model for the study of FIP1L1-PDG","We recently identified the chimeric kinase FIP1L1-platelet-derived growth factor receptor alpha (PDGFRalpha) as a cause of the hypereosinophilic syndrome and of chronic eosinophilic leukemia. To investigate the role of FIP1L1-PDGFRA in the pathogenesis of acute leukemia, we screened 87 leukemia cell lines for the presence of FIP1L1-PDGFRA. One cell line, EOL-1, expressed the FIP1L1-PDGFRA fusion. Three structurally divergent kinase inhibitors--imatinib (STI-571), PKC412, and SU5614--inhibited the growth of EOL-1 cells. These results indicate that the fusion of FIP1L1 to PDGFRA occurs rarely in leukemia cell lines, but they identify EOL-1 as an in vitro model for the study of FIP1L1-PDGFRA-positive chronic eosinophilic leukemia and for the analysis of small molecule inhibitors of FIP1L1-PDGFRalpha.","Apoptosis, Base Sequence, Benzamides, Biomarkers/analysis, Blotting, Western, Cell Division/drug effects, Cell Line, Tumor, DNA Primers, Enzyme Inhibitors/pharmacology, Humans, Hypereosinophilic Syndrome/*genetics, Imatinib Mesylate, Models, Biological, Piperazines/pharmacology, Pyri","Cools J, Quentmeier H, Huntly BJ, Marynen P, Griffin JD, Drexler HG, Gilliland DG","Blood. 2004 Apr 1;103(7):2802-5. doi","2004 Apr","10.1182/blood-2003-07-2479 [doi], 2003-07-2479 [pii]","Blood"
"134","28850922","Discovery of N-(5-((5-chloro-4-((2-(isopropylsulfonyl)phenyl)amino)p","Recently, more and more concomitant EGFR mutations and ALK rearrangement are observed from the clinic, which still lacks effective single-agent therapy. Starting from ALK inhibitor 14 (TAE684), we have developed a highly potent EGFR/ALK dual kinase inhibitor compound 18 (CHMFL-ALK/EGFR-050), which potently inhibited EGFR L858R, del 19 and T790M mutants as well as EML4-ALK, R1275Q, L1196M, F1174L and C1156Y mutants biochemically. Compound 18 significantly inhibited the proliferation of EGFR mutant and EML4-ALK driven NSCLC cell lines. In the cellular context it strongly affected EGFR and ALK mediated signaling pathways, induced apoptosis and arrested cell cycle at G0/G1 phase. In the in vivo studies, 18 significantly suppressed the tumor growth in H1975 cell inoculated xenograft model (40 mg/kg/d, TGI: 99%) and H3122 cell inoculated xenograft model (40 mg/kg/d, TGI: 78%). Compound 18 might be a ","Acrylamides/chemical synthesis/chemistry/*pharmacology, Anaplastic Lymphoma Kinase, Animals, Apoptosis/drug effects, Carcinoma, Non-Small-Cell Lung/*drug therapy/pathology, Cell Cycle/drug effects, Cell Line, Tumor, Cell Proliferation/drug effects, Dose-Response Relationship, Drug, *","Chen Y, Wu J, Wang A, Qi Z, Jiang T, Chen C, Zou F, Hu C, Wang W, Wu H, Hu Z, Wang W, Wang B, Wang L, Ren T, Zhang S, Liu Q, Liu J","Eur J Med Chem. 2017 Oct 20;139:674-697. doi","2017 Oct","S0223-5234(17)30638-4 [pii], 10.1016/j.ejmech.2017.08.035 [doi]","European journal of medicinal chemistry"
"135","2788468","CML-T1","Most data suggest that malignant transformation in chronic myelogenous leukemia (CML) occurs in hematopoietic stem cell that is the progenitor of myelopoiesis and of B but not T lymphopoiesis. We established a T-lymphoid cell line (CML-T1) from a person with Ph-chromosome-negative CML in acute phase. Evidence of its T-lymphocyte origin includes the pattern cytochemical reactivity, reactivity with anti-T-cell monoclonal antibodies (MoAbs), and rearrangement of the beta-T-cell receptor (TCRB) gene. CML-T1 cells have features of type IV thymocytes. Cytogenetic analyses indicate a 47,XX, del(11), t(6;7)(q23;q24), +mar karyotype. CML-T1 cells exhibit molecular changes typical of CML, including translocation of the ABL protooncogene from chromosome 9 to 22, rearrangement of the BCR gene, and transcription of a chimeric BCR-ABL messenger RNA (mRNA). The ABL insertion on chromosome 22 appears interstit","Adult, Biomarkers/analysis, Biomarkers, Tumor/analysis, Cell Line, Cell Transformation, Neoplastic/analysis/genetics/pathology, Female, Gene Rearrangement, T-Lymphocyte, Human T-lymphotropic virus 1/analysis, Humans, Karyotyping, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genet","Kuriyama K, Gale RP, Tomonaga M, Ikeda S, Yao E, Klisak I, Whelan K, Yakir H, Ichimaru M, Sparkes RS, et al.","Blood. 1989 Sep;74(4):1381-7.","1989 Sep","?","Blood"
"136","27078848","CRKL mediates EML4-ALK signaling and is a potential therapeutic targ","Anaplastic lymphoma kinase (ALK) gene rearrangements are oncogenic drivers in a small subset of patients with non-small-cell lung cancer (NSCLC). The ALK inhibitors are highly effective in NSCLC patients harboring ALK rearrangements; however, most patients acquire resistance to the therapy following an initial response. Mechanisms of acquired resistance are complex. We used LC-MS/MS-based phosphotyrosine-peptide profiling in the EML4-ALK rearranged H3122 and H2228 cells treated with ALK inhibitors, to identify downstream effectors of ALK. We then used Western blot, siRNA experiments, cell proliferation, viability and migration assays to validate our findings. We identified CRKL as a novel downstream effector of ALK signaling. We demonstrated that CRKL tyrosine phosphorylation was repressed by pharmacological inhibition or small interfering RNA (siRNA) knockdown of ALK in the ALK-rearranged cell","Adaptor Proteins, Signal Transducing/*metabolism, Carcinoma, Non-Small-Cell Lung/*genetics/metabolism/*pathology, Cell Line, Tumor, Drug Resistance, Neoplasm, Humans, Lung Neoplasms/genetics/*metabolism/*pathology, Nuclear Proteins/*metabolism, Oncogene Proteins, Fusion/*metabolism","An R, Wang Y, Voeller D, Gower A, Kim IK, Zhang YW, Giaccone G","Oncotarget. 2016 May 17;7(20):29199-210. doi","2016 May","8638 [pii], 10.18632/oncotarget.8638 [doi]","Oncotarget"
"137","18073350","Complete molecular response of e6a2 BCR-ABL-positive acute myeloid l","De novo presentation of acute myeloid leukemia (AML) expressing the Philadelphia (Ph) chromosomal abnormality is rare and is associated with a dismal prognosis. To date, reported cases of Ph(+) AML have expressed either the e13a2 or e14a2 BCR-ABL fusion transcripts. We report a unique case of de novo AML expressing the e6a2 fusion transcript and describe disease sensitivity to both imatinib before allogeneic stem-cell transplantation and dasatinib for AML relapse after allogeneic stem-cell transplantation. Furthermore, we report that sustained molecular remission has been achieved despite withdrawal of tyrosine kinase inhibitor (TKI) therapy.","Antineoplastic Agents/pharmacology/*therapeutic use, Benzamides, Bone Marrow/drug effects/pathology, Dasatinib, Female, Fusion Proteins, bcr-abl/genetics/metabolism, Gene Expression Regulation, Leukemic/drug effects, Humans, Imatinib Mesylate, Leukemia, Myelogenous, Chronic, BCR-ABL ","Ritchie DS, McBean M, Westerman DA, Kovalenko S, Seymour JF, Dobrovic A","Blood. 2008 Mar 1;111(5):2896-8. doi","2008 Mar","blood-2007-08-107508 [pii], 10.1182/blood-2007-08-107508 [doi]","Blood"
"138","11751994","Multilevel dysregulation of STAT3 activation in anaplastic lymphoma ","Accumulating evidence indicates that expression of anaplastic lymphoma kinase (ALK), typically due to t(2;5) translocation, defines a distinct type of T/null-cell lymphoma (TCL). The resulting nucleophosmin (NPM) /ALK chimeric kinase is constitutively active and oncogenic. Downstream effector molecules triggered by NPM/ALK remain, however, largely unidentified. Here we report that NPM/ALK induces continuous activation of STAT3. STAT3 displayed tyrosine phosphorylation and DNA binding in all (four of four) ALK+ TCL cell lines tested. The activation of STAT3 was selective because none of the other known STATs was consistently tyrosine phosphorylated in these cell lines. In addition, malignant cells in tissue sections from all (10 of 10) ALK+ TCL patients expressed tyrosine-phosphorylated STAT3. Transfection of BaF3 cells with NPM/ALK resulted in tyrosine phosphorylation of STAT3. Furthermore, STA","Anaplastic Lymphoma Kinase, Carrier Proteins/biosynthesis/genetics, Cell Line, DNA-Binding Proteins/*metabolism, Gene Expression Regulation, Neoplastic, Humans, Kinetics, Lymphoma, T-Cell/*enzymology/genetics/*metabolism, Models, Biological, Phosphoprotein Phosphatases/metabolism, Ph","Zhang Q, Raghunath PN, Xue L, Majewski M, Carpentieri DF, Odum N, Morris S, Skorski T, Wasik MA","J Immunol. 2002 Jan 1;168(1):466-74. doi","2002 Jan","10.4049/jimmunol.168.1.466 [doi]","Journal of immunology (Baltimore, Md."
"139","29455675","The function and therapeutic targeting of anaplastic lymphoma kinase","Lung cancer is the leading cause of death by cancer in North America. A decade ago, genomic rearrangements in the anaplastic lymphoma kinase (ALK) receptor tyrosine kinase were identified in a subset of non-small cell lung carcinoma (NSCLC) patients. Soon after, crizotinib, a small molecule ATP-competitive ALK inhibitor was proven to be more effective than chemotherapy in ALK-positive NSCLC patients. Crizotinib and two other ATP-competitive ALK inhibitors, ceritinib and alectinib, are approved for use as a first-line therapy in these patients, where ALK rearrangement is currently diagnosed by immunohistochemistry and in situ hybridization. The clinical success of these three ALK inhibitors has led to the development of next-generation ALK inhibitors with even greater potency and selectivity. However, patients inevitably develop resistance to ALK inhibitors leading to tumor relapse that commonly","Anaplastic Lymphoma Kinase/*antagonists & inhibitors/genetics/*metabolism, Antineoplastic Agents/pharmacology/therapeutic use, Biomarkers, Tumor, Carcinoma, Non-Small-Cell Lung/diagnosis/*drug therapy/*metabolism, Gene Rearrangement, Humans, Lung Neoplasms/diagnosis/*drug therapy/*me","Golding B, Luu A, Jones R, Viloria-Petit AM","Mol Cancer. 2018 Feb 19;17(1):52. doi","2018 Feb","10.1186/s12943-018-0810-4 [doi], 10.1186/s12943-018-0810-4 [pii]","Molecular cancer"
"140","28504721","Tumour exosomes from cells harbouring PTPRZ1-MET fusion contribute t","Exosomes are carriers of pro-tumorigenic factors that participate in glioblastoma (GBM) progression, and many fusion genes are strong driver mutations in neoplasia and are involved in tumorigenesis. However, the ability of fusion genes to be transduced by exosomes is unknown. We characterized exosomes from GBM cells harbouring and not harbouring PTPRZ1-MET fusion (ZM fusion). We also determined the effect of the exosomes from ZM fusion cells (ZM exosomes) on pro-oncogenic secretions and showed that ZM exosomes are internalized by the recipient cells. In addition, we studied the effect of ZM exosome-mediated intercellular communication in the GBM microenvironment. MET proto-oncogene expression was higher in ZM exosomes. Moreover, phosphorylated MET was detected only in ZM exosomes and not in exosomes released by non-ZM fusion GBM cells. ZM exosomes transferred to non-ZM fusion GBM cells and norm","Animals, Antineoplastic Agents, Alkylating/*pharmacology, Cell Communication, Cell Line, Tumor, Dacarbazine/*analogs & derivatives/pharmacology, Drug Resistance, Neoplasm, Exosomes/*metabolism, Glioblastoma/*drug therapy/genetics/metabolism/pathology, Humans, Male, Mice, Inbred BALB ","Zeng AL, Yan W, Liu YW, Wang Z, Hu Q, Nie E, Zhou X, Li R, Wang XF, Jiang T, You YP","Oncogene. 2017 Sep 21;36(38):5369-5381. doi","2017 Sep","onc2017134 [pii], 10.1038/onc.2017.134 [doi]","Oncogene"
"141","8187071","Nucleophosmin (NPM) gene rearrangements in Ki-1-positive lymphomas.","The (2;5)(p23;q35) translocation which results in the fusion of the NPM (nucleophosmin) gene on chromosome 5q35 with the novel ALK (anaplastic lymphoma kinase) gene on chromosome 2p23 [S.W. Morris et al., Science (Washington DC), 263: 1281-1284, 1994] is associated with Ki-1 (CD30)-positive anaplastic large cell lymphomas (ALCL); a group of morphologically and immunophenotypically heterogenous high grade large cell lymphomas (LCL), which share many characteristics with Hodgkin's disease (HD), including the presence of variable numbers of Reed-Sternberg-like cells and the expression of CD30 antigen. Using a DNA probe immediately 5' to the NPM coding sequences, we have examined NPM gene rearrangements by Southern blotting in 5 Ki-1-positive lymphoma cell lines carrying a translocation involving the 5q35 breakpoint and in 25 Ki-positive lymphoma tumors, including 9 HD. Using this method, we detect","Chromosomes, Human, Pair 2, Chromosomes, Human, Pair 5, Chromosomes, Human, Pair 6, Gene Rearrangement, T-Lymphocyte/*genetics, Hodgkin Disease/*genetics, Humans, Lymphoma, Large-Cell, Anaplastic/*genetics, Nuclear Proteins/chemistry/*genetics, Translocation, Genetic/genetics, Tumor ","Bullrich F, Morris SW, Hummel M, Pileri S, Stein H, Croce CM","Cancer Res. 1994 Jun 1;54(11):2873-7.","1994 Jun","?","Cancer research"
"142","2194587","Immunologic characterization of the tumor-specific bcr-abl junction ","Philadelphia (Ph')-positive acute lymphoblastic leukemia (ALL) is highly associated with two forms of chimeric bcr-abl proteins: P190bcr-abl and P210bcr-abl. Whereas P210bcr-abl also occurs in chronic myeloid leukemia, P190bcr-abl is uniquely expressed in Ph'-positive ALL. As a consequence, P190bcr-abl is preeminently a tumor-specific marker in leukemic cells of ALL patients. Because P190bcr-abl is composed of the normal bcr and abl proteins, the major part of the P190bcr-abl molecule comprises nontumor-specific determinants. The joining region between bcr and abl, newly generated during the Ph' translocation, is exclusively a tumor-specific epitope on the P190bcr-abl molecule. Therefore, only antibodies against the bcr-abl joining region will detect the tumor-specificity of P190bcr-abl. In this study a polyclonal antiserum, termed BP-ALL, was raised against a synthetic peptide corresponding to","Adult, Amino Acid Sequence, Amino Acids/analysis, Cell Line, Chimera/immunology, DNA/analysis/genetics, Gene Expression Regulation, Neoplastic, Humans, Immune Sera/immunology, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/diagnosis/*genetics/immunology, Male, Middle Aged, Molecula","van Denderen J, van der Plas D, Meeuwsen T, Zegers N, Boersma W, Grosveld G, van Ewijk W","Blood. 1990 Jul 1;76(1):136-41.","1990 Jul","?","Blood"
"143","26087013","Clonal Evolution and Blast Crisis Correlate with Enhanced Proteolyti","Unbalanced (major route) additional cytogenetic aberrations (ACA) at diagnosis of chronic myeloid leukemia (CML) indicate an increased risk of progression and shorter survival. Moreover, newly arising ACA under imatinib treatment and clonal evolution are considered features of acceleration and define failure of therapy according to the European LeukemiaNet (ELN) recommendations. On the basis of 1151 Philadelphia chromosome positive chronic phase patients of the randomized CML-study IV, we examined the incidence of newly arising ACA under imatinib treatment with regard to the p210BCR-ABL breakpoint variants b2a2 and b3a2. We found a preferential acquisition of unbalanced ACA in patients with b3a2 vs. b2a2 fusion type (ratio: 6.3 vs. 1.6, p = 0.0246) concurring with a faster progress to blast crisis for b3a2 patients (p = 0.0124). ESPL1/Separase, a cysteine endopeptidase, is a key player in chrom","Adolescent, Adult, Aged, Aged, 80 and over, Antineoplastic Agents/*therapeutic use, Blast Crisis/enzymology/*genetics/pathology, Cell Line, Tumor, Chromosome Aberrations, Chromosome Breakage, Clonal Evolution, Fusion Proteins, bcr-abl/*genetics, Humans, Imatinib Mesylate/*therapeutic","Haass W, Kleiner H, Weiss C, Haferlach C, Schlegelberger B, Muller MC, Hehlmann R, Hofmann WK, Fabarius A, Seifarth W","PLoS One. 2015 Jun 18;10(6):e0129648. doi","2015","10.1371/journal.pone.0129648 [doi], PONE-D-15-07637 [pii]","PloS one"
"144","17432977","Establishment and characterization of a novel imatinib-sensitive chr","In chronic myeloid leukemia (CML), resistance to imatinib is diverse. In addition to BCR-ABL-dependent mechanisms, BCR-ABL-independent mechanisms have been proposed. Here we established and characterized novel CML cell lines, an imatinib-sensitive cell line, MYL, and an imatinib-resistant subline, MYL-R. Treatment with imatinib inhibited phosphorylation of BCR-ABL and CrkL in both MYL and MYL-R, even though imatinib-induced apoptosis was preferentially observed in MYL than MYL-R, indicating that the resistance is based on a BCR-ABL-independent mechanism. MYL-R showed elevated expressions of Lyn mRNA, Lyn protein, phosphorylated Lyn, and phosphorylated STAT5. Silencing of Lyn by short-interfering RNA (siRNA) in MYL-R, but not in MYL, induced significant growth-inhibition, increased caspase-3 activity, and induced partial recovery from imatinib-resistance. Expression of Bcl-2, previously reported","Adult, Antineoplastic Agents/*pharmacology, Apoptosis, Base Sequence, Benzamides, Cell Line, Tumor, DNA Primers, Drug Resistance, Neoplasm/*genetics, Female, Genes, abl, Humans, Imatinib Mesylate, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*pathology, Oligonucleotide Array Sequ","Ito T, Tanaka H, Kimura A","Eur J Haematol. 2007 May;78(5):417-31. doi","2007 May","EJH835 [pii], 10.1111/j.1600-0609.2007.00835.x [doi]","European journal of haematology"
"145","26639656","EMT is associated with, but does not drive resistance to ALK inhibit","ALK gene fusion occurs in approximately 3-7% of non-small cell lung cancer (NSCLC). For patients with ALK positive NCSLC, crizotinib and ceritinib are FDA approved ALK inhibitors, however, patients inevitably acquire resistance to such therapies typically within one to two years. Interrogation of in vitro ALK-positive NSCLC cell line models of acquired resistance to first and second-generation ALK inhibitors revealed acquired epithelial-to-mesenchymal transition (EMT) mechanisms. Here we demonstrated that knockdown of upregulated mesenchymal markers in acquired resistant lines decreased the invasive and migratory capabilities of the cells, however, it did not restore sensitivity to ALK inhibitors. Removing drug for 5 weeks from H3122 cell line that acquired resistance to ceritinib restored its sensitivity to ceritinib. In addition, HSP90 inhibitors ganetespib and 17-AAG were potent in inducing ","*Biomarkers, Tumor/biosynthesis/genetics, *Carcinoma, Non-Small-Cell Lung/drug therapy/genetics/metabolism/pathology, Cell Line, Tumor, *Drug Resistance, Neoplasm, Enzyme Inhibitors/*pharmacology, *Epithelial-Mesenchymal Transition/drug effects/genetics, Gene Expression Regulation, N","Gower A, Hsu WH, Hsu ST, Wang Y, Giaccone G","Mol Oncol. 2016 Apr;10(4):601-9. doi","2016 Apr","S1574-7891(15)00206-9 [pii], 10.1016/j.molonc.2015.11.007 [doi]","Molecular oncology"
"146","23578175","Identification of a lung adenocarcinoma cell line with CCDC6-RET fus","Rearrangements of the proto-oncogene RET are newly identified potential driver mutations in lung adenocarcinoma (LAD). However, the absence of cell lines harboring RET fusion genes has hampered the investigation of the biological relevance of RET and the development of RET-targeted therapy. Thus, we aimed to identify a RET fusion positive LAD cell line. Eleven LAD cell lines were screened for RET fusion transcripts by reverse transcription-polymerase chain reaction. The biological relevance of the CCDC6-RET gene products was assessed by cell growth, survival and phosphorylation of ERK1/2 and AKT with or without the suppression of RET expression using RNA interference. The efficacy of RET inhibitors was evaluated in vitro using a culture system and in an in vivo xenograft model. Expression of the CCDC6-RET fusion gene in LC-2/ad cells was demonstrated by the mRNA and protein levels, and the geno","Adenocarcinoma/*drug therapy/*genetics/metabolism, Adenocarcinoma of Lung, Animals, Antineoplastic Agents/pharmacology, Apoptosis/drug effects, Cell Cycle Checkpoints/drug effects, Cell Line, Tumor, Cell Proliferation/drug effects, Cell Survival/drug effects, Cytoskeletal Proteins/*g","Suzuki M, Makinoshima H, Matsumoto S, Suzuki A, Mimaki S, Matsushima K, Yoh K, Goto K, Suzuki Y, Ishii G, Ochiai A, Tsuta K, Shibata T, Kohno T, Esumi H, Tsuchihara K","Cancer Sci. 2013 Jul;104(7):896-903. doi","2013 Jul","10.1111/cas.12175 [doi]","Cancer science"
"147","24972969","Blocking the PI3K pathway enhances the efficacy of ALK-targeted ther","Targeted therapy based on ALK tyrosine kinase inhibitors (ALK-TKIs) has made significant achievements in individuals with EML4-ALK (echinoderm microtubule-associated protein-like 4 gene and the anaplastic lymphoma kinase gene) fusion positive nonsmall-cell lung cancer (NSCLC). However, a high fraction of patients receive inferior clinical response to such treatment in the initial therapy, and the exact mechanisms underlying this process need to be further investigated. In this study, we revealed a persistently activated PI3K/AKT signaling that mediates the drug ineffectiveness. We found that genetic or pharmacological inhibition of ALK markedly abrogated phosphorylated STAT3 and ERK, but it failed to suppress AKT activity or induce apoptosis, in EML4-ALK-positive H2228 cells. Furthermore, targeted RNA interference of PI3K pathway components restored sensitivity to TAE684 treatment at least part","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Combined Chemotherapy Protocols/pharmacology, Apoptosis/drug effects, Carcinoma, Non-Small-Cell Lung/genetics/*metabolism, Cell Line, Tumor, Drug Resistance, Neoplasm/*physiology, Heterografts, Humans, Immunoblotting, Lung Neoplasms","Yang L, Li G, Zhao L, Pan F, Qiang J, Han S","Tumour Biol. 2014 Oct;35(10):9759-67. doi","2014 Oct","10.1007/s13277-014-2252-y [doi]","Tumour biology"
"148","26657151","Excess of NPM-ALK oncogenic signaling promotes cellular apoptosis an","Most of the anaplastic large-cell lymphoma (ALCL) cases carry the t(2;5; p23;q35) that produces the fusion protein NPM-ALK (nucleophosmin-anaplastic lymphoma kinase). NPM-ALK-deregulated kinase activity drives several pathways that support malignant transformation of lymphoma cells. We found that in ALK-rearranged ALCL cell lines, NPM-ALK was distributed in equal amounts between the cytoplasm and the nucleus. Only the cytoplasmic portion was catalytically active in both cell lines and primary ALCL, whereas the nuclear portion was inactive because of heterodimerization with NPM1. Thus, about 50% of the NPM-ALK is not active and sequestered as NPM-ALK/NPM1 heterodimers in the nucleus. Overexpression or relocalization of NPM-ALK to the cytoplasm by NPM genetic knockout or knockdown caused ERK1/2 (extracellular signal-regulated protein kinases 1 and 2) increased phosphorylation and cell death throu","Animals, *Apoptosis, Blotting, Western, Cell Line, Tumor, Cell Survival/drug effects/genetics, Cells, Cultured, Crizotinib, Dose-Response Relationship, Drug, Drug Synergism, Extracellular Signal-Regulated MAP Kinases/metabolism, Histones/metabolism, Humans, Hydrazines/pharmacology, L","Ceccon M, Merlo MEB, Mologni L, Poggio T, Varesio LM, Menotti M, Bombelli S, Rigolio R, Manazza AD, Di Giacomo F, Ambrogio C, Giudici G, Casati C, Mastini C, Compagno M, Turner SD, Gambacorti-Passerini C, Chiarle R, Voena C","Oncogene. 2016 Jul 21;35(29):3854-3865. doi","2016 Jul","10.1038/onc.2015.456 [doi]","Oncogene"
"149","26554155","Modulating the Growth and Imatinib Sensitivity of Chronic Myeloid Le","Chronic myeloid leukemia (CML) originates from normal hematopoietic stem cells acquiring Philadelphia chromosome (Ph) to generate BCR-ABL fusion gene whose protein product has deregulated tyrosine kinase activity. Specific inhibitors against BCR-ABL, such as Imatinib mesylate (IM), have greatly improved CML management; however, no single agent is a cure yet. Delivery of microRNA (miRNA) using non-viral vectors has been utilized to inhibit various cancer cells; however, the efficacy of this approach to target CML stem/progenitor cells has not been elucidated. In this study, we firstly validated that spermine-introduced pullulan (Ps) was a robust non-viral vector for delivery of miRNA to CML cells, including the CD34+ cells from clinical isolates. We then found that the miR-181a/RALA (V-ral simian leukemia viral oncogene homolog A) axis was aberrantly expressed in the CML CD34+ cells. The deliver","Adult, Aged, Antineoplastic Agents/chemistry/pharmacokinetics/*pharmacology, Cell Line, Tumor, Cell Survival/drug effects, Drug Resistance, Neoplasm/*drug effects, Female, Glucans/chemistry, Humans, Imatinib Mesylate/chemistry/pharmacokinetics/*pharmacology, Leukemia, Myelogenous, Ch","Ma W, Liu J, Xie J, Zhang X, Zhou H, Yao H, Zhang W, Guo D, Zhu L, Xiao L, Wu D, Xu H, Chen S, Zhao Y","J Biomed Nanotechnol. 2015 Nov;11(11):1961-74. doi","2015 Nov","10.1166/jbn.2015.2147 [doi]","Journal of biomedical nanotechnology"
"150","2825022","A new fused transcript in Philadelphia chromosome positive acute lym","The leukaemic cells of more than 90% of chronic myelogenous leukaemia (CML) patients and of 10% of acute lymphocytic leukaemia (ALL) patients carry the t(9:22) (q34:q11) translocation which generates the Philadelphia chromosome (Ph1). In CML the abl gene is translocated from chromosome 9 to the centre of the bcr gene on chromosome 22 and this results in production of chimaeric bcr-abl RNA translated into a protein of relative molecular mass (Mr) 210,000 (210K). Our data indicate that in ALL abl is translocated into the 5' region of the bcr gene. The consequence of this is the expression of a fused transcript in which the first exon of bcr is linked to the second abl exon. This transcript encodes a 190K protein kinase.","Amino Acid Sequence, Base Sequence, Chimera, DNA Restriction Enzymes, *Genes, Humans, Leukemia, Lymphoid/*genetics, Molecular Sequence Data, *Philadelphia Chromosome, Protein Biosynthesis, Protein Kinases/*genetics, RNA, Messenger/genetics, *Transcription, Genetic","Fainstein E, Marcelle C, Rosner A, Canaani E, Gale RP, Dreazen O, Smith SD, Croce CM","Nature. 1987 Nov 26-Dec 2;330(6146):386-8. doi","1987 Nov","10.1038/330386a0 [doi]","Nature"
"151","28515100","Detection of Chromosomal Translocation in Hematologic Malignancies b","BACKGROUND: Disease-defining chromosomal translocations are seen in various neoplasms, especially in lymphomas and leukemias. Translocation detection at the DNA level is often complicated by chromosomal breakpoints that are distributed over very large regions. We have developed a ligation-based assay [the looped ligation assay (LOLA)] to detect translocations from diseases with multiple widely spaced breakpoint hot spots. METHODS: Oligonucleotide sets that probe breakpoints of IGH-BCL2 (immunoglobulin heavy-apoptosis regulator) in follicular lymphoma (FL), MYC-IGH (MYC proto-oncogene, bHLH transcription factor-immunoglobulin heavy) in Burkitt lymphoma (BL) and BCR-ABL1 (RhoGEF and GTPase activating protein-ABL proto-oncogene 1, non-receptor tyrosine kinase) in chronic myelogenous leukemia (CML) were designed. DNA from cell lines with these translocations was mixed with oligonucleotides in a sin","Biological Assay/*standards, Cell Line, *Genetic Techniques, Hematologic Neoplasms/*diagnosis/*genetics, Humans, Lymphoma, Follicular/diagnosis/genetics, Reproducibility of Results, Translocation, Genetic/*genetics","Harada S, Sizzle E, Lin MT, Gocke CD","Clin Chem. 2017 Jul;63(7):1278-1287. doi","2017 Jul","clinchem.2016.270140 [pii], 10.1373/clinchem.2016.270140 [doi]","Clinical chemistry"
"152","26002693","1,3-Butadiene, CML and the t(9:22) translocation","Epidemiological studies of 1,3-butadiene have suggest that exposures to humans are associated with chronic myeloid leukemia (CML). CML has a well-documented association with ionizing radiation, but reports of associations with chemical exposures have been questioned. Ionizing radiation is capable of inducing the requisite CML-associated t(9:22) translocation (Philadelphia chromosome) in appropriate cells in vitro but, thus far, chemicals have not shown this capacity. We have proposed that 1,3-butadiene metabolites be so tested as a reality check on the epidemiological reports. In order to conduct reliable testing in this regard, it is essential that a positive control for induction be available. We have used ionizing radiation to develop such a control. Results described here demonstrate that this agent does in fact induce pathogenic t(9:22) translocations in a human myeloid cell line in vitro,","Butadienes/*toxicity, Cell Line, Tumor, HL-60 Cells, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics, Myeloid Cells/drug effects, Philadelphia Chromosome/*drug effects, Translocation, Genetic/*drug effects/*genetics","Albertini RJ, Carter EW, Nicklas JA, Vacek PM, Walker VE","Chem Biol Interact. 2015 Nov 5;241:32-9. doi","2015 Nov","S0009-2797(15)00210-0 [pii], 10.1016/j.cbi.2015.05.011 [doi]","Chemico-biological interactions"
"153","25820993","Oncogenic role of miR-155 in anaplastic large cell lymphoma lacking ","Anaplastic large cell lymphoma (ALCL) is a rare, aggressive, non-Hodgkin's lymphoma that is characterized by CD30 expression and disease onset in young patients. About half of ALCL patients bear the t(2;5)(p23;q35) translocation, which results in the formation of the nucleophosmin-anaplastic lymphoma tyrosine kinase (NPM-ALK) fusion protein (ALCL ALK(+)). However, little is known about the molecular features and tumour drivers in ALK-negative ALCL (ALCL ALK(-)), which is characterized by a worse prognosis. We found that ALCL ALK(-), in contrast to ALCL ALK(+), lymphomas display high miR-155 expression. Consistent with this, we observed an inverse correlation between miR-155 promoter methylation and miR-155 expression in ALCL. However, no direct effect of the ALK kinase on miR-155 levels was observed. Ago2 immunoprecipitation revealed miR-155 as the most abundant miRNA, and enrichment of target ","Anaplastic Lymphoma Kinase, Animals, Argonaute Proteins/genetics/metabolism, CCAAT-Enhancer-Binding Protein-beta/genetics/metabolism, Case-Control Studies, Caspase 3/metabolism, Cell Line, Tumor, *Chromosomes, Human, Pair 2, *Chromosomes, Human, Pair 5, DNA Methylation, Gene Expressi","Merkel O, Hamacher F, Griessl R, Grabner L, Schiefer AI, Prutsch N, Baer C, Egger G, Schlederer M, Krenn PW, Hartmann TN, Simonitsch-Klupp I, Plass C, Staber PB, Moriggl R, Turner SD, Greil R, Kenner L","J Pathol. 2015 Aug;236(4):445-56. doi","2015 Aug","10.1002/path.4539 [doi]","The Journal of pathology"
"154","23239810","Crizotinib-resistant NPM-ALK mutants confer differential sensitivity","The dual ALK/MET inhibitor crizotinib was recently approved for the treatment of metastatic and late-stage ALK+ NSCLC, and is currently in clinical trial for other ALK-related diseases. As predicted after other tyrosine kinase inhibitors' clinical experience, the first mutations that confer resistance to crizotinib have been described in patients with non-small cell lung cancer (NSCLC) and in one patient inflammatory myofibroblastic tumor (IMT). Here, we focused our attention on the anaplastic large cell lymphoma (ALCL), where the oncogenic fusion protein NPM-ALK, responsible for 70% to 80% of cases, represents an ideal crizotinib target. We selected and characterized 2 human NPM-ALK+ ALCL cell lines, KARPAS-299 and SUP-M2, able to survive and proliferate at different crizotinib concentrations. Sequencing of ALK kinase domain revealed that a single mutation became predominant at high crizotinib","Anaplastic Lymphoma Kinase, Animals, Apoptosis/drug effects, Cell Growth Processes/drug effects, Cell Line, Tumor, Crizotinib, Drug Resistance, Neoplasm, Humans, Lymphoma, Large-Cell, Anaplastic/drug therapy/enzymology/pathology, Mice, Models, Molecular, Protein Kinase Inhibitors/*ph","Ceccon M, Mologni L, Bisson W, Scapozza L, Gambacorti-Passerini C","Mol Cancer Res. 2013 Feb;11(2):122-32. doi","2013 Feb","1541-7786.MCR-12-0569 [pii], 10.1158/1541-7786.MCR-12-0569 [doi]","Molecular cancer research"
"155","27908728","Activation of EVI1 transcription by the LEF1/beta-catenin complex wi","The presence of a BCR-ABL1 fusion gene is necessary for the pathogenesis of chronic myeloid leukemia (CML) through t(9;22)(q34;q11) translocation. Imatinib, an ABL tyrosine kinase inhibitor, is dramatically effective in CML patients; however, 30% of CML patients will need further treatment due to progression of CML to blast crisis (BC). Aberrant high expression of ecotropic viral integration site 1 (EVI1) is frequently observed in CML during myeloid-BC as a potent driver with a CML stem cell signature; however, the precise molecular mechanism of EVI1 transcriptional regulation during CML progression is poorly defined. Here, we demonstrate the transcriptional activity of EVI1 is dependent on activation of lymphoid enhancer-binding factor 1 (LEF1)/beta-catenin complex by BCR-ABL with loss of p53 function during CML-BC. The activation of beta-catenin is partly dependent on BCR-ABL expression throu","Animals, Blast Crisis/*genetics/metabolism/pathology, Cell Line, Tumor, DNA-Binding Proteins/*genetics, *Gene Expression Regulation, Leukemic, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics/metabolism/pathology, Lymphoid Enhancer-Binding Factor 1/*metabolism, MDS1 ","Manachai N, Saito Y, Nakahata S, Bahirvani AG, Osato M, Morishita K","Biochem Biophys Res Commun. 2017 Jan 22;482(4):994-1000. doi","2017 Jan","S0006-291X(16)32020-4 [pii], 10.1016/j.bbrc.2016.11.146 [doi]","Biochemical and biophysical research communications"
"156","25301075","Management of NSCLC","INTRODUCTION: Presence of Anaplastic lymphoma kinase (ALK) translocations identifies a distinct subgroup of NSCLC with different prognosis and therapeutic opportunities. In cancer cells, ALK gene fusion acts as oncogenic driver, representing an attractive therapeutic target in NSCLC. AREAS COVERED: For the purpose of this review article, data from preclinical and clinical trials with crizotinib were collected and analyzed. EXPERT OPINION: Available data demonstrated that crizotinib is the best option we can offer today to ALK-positive NSCLC not previously exposed to ALK inhibitors, irrespective of line of therapy. In two large Phase III trials, crizotinib demonstrated to improve response rate and progression-free survival when compared to standard chemotherapy, both in first- and second-line treatment. Furthermore, results from pivotal Phase I and II studies indicated that crizotinib was active","Anaplastic Lymphoma Kinase, Animals, Carcinoma, Non-Small-Cell Lung/*drug therapy/enzymology/genetics, Clinical Trials as Topic, Crizotinib, Disease-Free Survival, Drug Resistance, Neoplasm, Humans, Lung Neoplasms/*drug therapy/enzymology/genetics, Mutation, Prognosis, Protein Kinase","Landi L, Cappuzzo F","Expert Opin Pharmacother. 2014 Dec;15(17):2587-97. doi","2014 Dec","10.1517/14656566.2014.970174 [doi]","Expert opinion on pharmacotherapy"
"157","28450729","Collateral sensitivity networks reveal evolutionary instability and ","Drug resistance remains an elusive problem in cancer therapy, particularly for novel targeted therapies. Much work is focused upon the development of an arsenal of targeted therapies, towards oncogenic driver genes such as ALK-EML4, to overcome the inevitable resistance that develops over time. Currently, after failure of first line ALK TKI therapy, another ALK TKI is administered, though collateral sensitivity is not considered. To address this, we evolved resistance in an ALK rearranged non-small cell lung cancer line (H3122) to a panel of 4 ALK TKIs, and performed a collateral sensitivity analysis. All ALK inhibitor resistant cell lines displayed significant cross-resistance to all other ALK inhibitors. We then evaluated ALK-inhibitor sensitivities after drug holidays of varying length (1-21 days), and observed dynamic patterns of resistance. This unpredictability led us to an expanded searc","Anaplastic Lymphoma Kinase, Antineoplastic Agents/*pharmacology, Carcinoma, Non-Small-Cell Lung/*pathology, Cell Line, Tumor, *Drug Resistance, Neoplasm, Humans, Protein Kinase Inhibitors/*pharmacology, Receptor Protein-Tyrosine Kinases/*antagonists & inhibitors/*genetics","Dhawan A, Nichol D, Kinose F, Abazeed ME, Marusyk A, Haura EB, Scott JG","Sci Rep. 2017 Apr 27;7(1):1232. doi","2017 Apr","10.1038/s41598-017-00791-8 [doi], 10.1038/s41598-017-00791-8 [pii]","Scientific reports"
"158","23233201","PECAM-1 is involved in BCR/ABL signaling and may downregulate imatin","PECAM-1 (CD31) is an immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing surface glycoprotein expressed on various hematopoietic cells as well as on endothelial cells. PECAM-1 has been shown to play roles in regulation of adhesion, migration and apoptosis. The BCR/ABL fusion tyrosine kinase is expressed in chronic myeloid leukemia and Philadelphia-positive (Ph+) acute lymphoblastic leukemia cells, and its inhibition by the clinically used tyrosine kinase inhibitors imatinib or dasatinib induces apoptosis of these cells. In the present study, we demonstrate that PECAM-1 is tyrosine phospho-rylated in its ITIM motifs in various BCR/ABL-expressing cells including primary leukemia cells. Studies using imatinib and dasatinib as well as transient expression experiments in 293T cells revealed that PECAM-1 was phosphorylated directly by BCR/ABL, which was enhanced by the imatinib-resistant","Apoptosis/drug effects, Benzamides/*pharmacology, Cell Adhesion/drug effects/genetics, Drug Resistance, Neoplasm/genetics, Fusion Proteins, bcr-abl/genetics/*metabolism, Gene Expression Regulation, Neoplastic/drug effects, Humans, Imatinib Mesylate, K562 Cells, Leukemia, Myelogenous,","Wu N, Kurosu T, Oshikawa G, Nagao T, Miura O","Int J Oncol. 2013 Feb;42(2):419-28. doi","2013 Feb","10.3892/ijo.2012.1729 [doi]","International journal of oncology"
"159","21299849","BCR-ABL1-independent PI3Kinase activation causing imatinib-resistanc","BACKGROUND: The BCR-ABL1 translocation occurs in chronic myeloid leukemia (CML) and in 25% of cases with acute lymphoblastic leukemia (ALL). The advent of tyrosine kinase inhibitors (TKI) has fundamentally changed the treatment of CML. However, TKI are not equally effective for treating ALL. Furthermore, de novo or secondary TKI-resistance is a significant problem in CML. We screened a panel of BCR-ABL1 positive ALL and CML cell lines to find models for imatinib-resistance. RESULTS: Five of 19 BCR-ABL1 positive cell lines were resistant to imatinib-induced apoptosis (KCL-22, MHH-TALL1, NALM-1, SD-1, SUP-B15). None of the resistant cell lines carried mutations in the kinase domain of BCR-ABL1 and all showed resistance to second generation TKI, nilotinib or dasatinib. STAT5, ERK1/2 and the ribosomal S6 protein (RPS6) are BCR-ABL1 downstream effectors, and all three proteins are dephosphorylated b","Apoptosis/drug effects, Benzamides, Drug Resistance, Neoplasm, Enzyme Activation, Fusion Proteins, bcr-abl/*metabolism, Humans, Imatinib Mesylate, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*drug therapy/*enzymology/pathology, Phosphatidylinositol 3-Kinases/*metabolism, Phospho","Quentmeier H, Eberth S, Romani J, Zaborski M, Drexler HG","J Hematol Oncol. 2011 Feb 7;4:6. doi","2011 Feb","1756-8722-4-6 [pii], 10.1186/1756-8722-4-6 [doi]","Journal of hematology & oncology"
"160","7815887","Large-cell anaplastic lymphoma-specific translocation (t[2;5] [p23;q","Chromosomal aberrations are characteristic and specific events; the detection of chromosomal abnormalities often provides information on diagnosis and prognosis of disease. Some patients with large-cell anaplastic lymphoma (Ki 1 lymphoma) have the translocation t(2;5) (p23; q35), involving a possible growth-regulating tyrosine kinase. We found this translocation in 11 patients with Hodgkin's disease of nodular sclerosis and mixed-cellularity types. This finding has implications for the understanding of the relation between large-cell anaplastic lymphoma and Hodgkin's disease, diseases with morphological and immunophenotypical similarities. Study of this translocation may help understanding of the origins of cancer and cancer growth. It also allows a more precise definition of Hodgkin's disease and may be used as an indicator for clonality--which has long been sought.","Actins/genetics, Anaplastic Lymphoma Kinase, Base Sequence, Hodgkin Disease/*genetics, Humans, Lymphoma, Large-Cell, Anaplastic/*genetics, Molecular Sequence Data, Nuclear Proteins/genetics, Polymerase Chain Reaction, Protein-Tyrosine Kinases/genetics, Receptor Protein-Tyrosine Kinas","Orscheschek K, Merz H, Hell J, Binder T, Bartels H, Feller AC","Lancet. 1995 Jan 14;345(8942):87-90. doi","1995 Jan","S0140-6736(95)90061-6 [pii], 10.1016/s0140-6736(95)90061-6 [doi]","Lancet (London, England)"
"161","23788756","The frequency and impact of ROS1 rearrangement on clinical outcomes ","BACKGROUND: To determine the frequency and predictive impact of ROS1 rearrangements on treatment outcomes in never-smoking patients with lung adenocarcinoma. PATIENTS AND METHODS: We concurrently analyzed ROS1 and ALK rearrangements and mutations in the epidermal growth factor receptor (EGFR), and KRAS in 208 never smokers with lung adenocarcinoma. ROS1 and ALK rearrangements were identified by fluorescent in situ hybridization. RESULTS: Of 208 tumors screened, 7 (3.4%) were ROS1 rearranged, and 15 (7.2%) were ALK-rearranged. CD74-ROS1 fusions were identified in two patients using reverse transcriptase-polymerase chain reaction. The frequency of ROS1 rearrangement was 5.7% (6 of 105) among EGFR/KRAS/ALK-negative patients. Patients with ROS1 rearrangement had a higher objective response rate (ORR; 60.0% versus 8.5%; P = 0.01) and a longer median progression-free survival (PFS; not reached versus","Adenocarcinoma/drug therapy/*genetics, Adenocarcinoma of Lung, Adult, Aged, Anaplastic Lymphoma Kinase, Antigens, Differentiation, B-Lymphocyte/genetics, Carcinoma, Non-Small-Cell Lung/drug therapy/*genetics, Cell Line, Tumor, Cell Survival/drug effects, Crizotinib, Disease-Free Surv","Kim HR, Lim SM, Kim HJ, Hwang SK, Park JK, Shin E, Bae MK, Ou SH, Wang J, Jewell SS, Kang DR, Soo RA, Haack H, Kim JH, Shim HS, Cho BC","Ann Oncol. 2013 Sep;24(9):2364-70. doi","2013 Sep","S0923-7534(19)36950-9 [pii], 10.1093/annonc/mdt220 [doi]","Annals of oncology"
"162","24149177","High ALK mRNA expression has a negative prognostic significance in r","BACKGROUND: Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase aberrantly expressed in cancer, but its clinical and functional importance remain controversial. Mutation or amplification of ALK, as well as its expression levels assessed by conventional immunohistochemistry methods, has been linked to prognosis in cancer, although with potential bias because of the semi-quantitative approaches. Herein, we measured ALK mRNA expression in rhabdomyosarcoma (RMS) and determined its clinical impact on patients' stratification and outcome. METHODS: Specimens were obtained from RMS patients and cell lines, and ALK expression was analysed by quantitative RT-PCR, western blotting, IHC, and copy number analysis. RESULTS: High ALK mRNA expression was detected in the vast majority of PAX3/7-FOXO1-positive tumours, whereas PAX3/7-FOXO1-negative RMS displayed considerably lower amounts of both mRNA","Anaplastic Lymphoma Kinase, Cell Line, Tumor, Child, Female, Gene Expression, Humans, Immunohistochemistry, Male, Prognosis, RNA, Messenger/*biosynthesis/genetics, Receptor Protein-Tyrosine Kinases/*biosynthesis/genetics, Rhabdomyosarcoma/*enzymology/genetics/pathology, Survival Anal","Bonvini P, Zin A, Alaggio R, Pawel B, Bisogno G, Rosolen A","Br J Cancer. 2013 Dec 10;109(12):3084-91. doi","2013 Dec","bjc2013653 [pii], 10.1038/bjc.2013.653 [doi]","British journal of cancer"
"163","10994999","Pathobiology of NPM-ALK and variant fusion genes in anaplastic large","Despite its clinical and histological heterogeneity, anaplastic large cell lymphoma (ALCL) is now a well-recognized clinicopathological entity accounting for 2% of all adult non-Hodgkin's lymphomas (NHL) and about 13% of pediatric NHL. Immunophenotypically, ALCL are of T cell (predominantly) or Null cell type; by definition, cases expressing B cell antigens are officially not included in this entity. The translocation (2;5)(p23;q35) is a recurring abnormality in ALCL; 46% of the ALCL patients bear this signature translocation. This translocation creates a fusion gene composed of nucleophosmin (NPM) and a novel receptor tyrosine kinase gene, named anaplastic lymphoma kinase (ALK). The NPM-ALK chimeric gene encodes a constitutively activated tyrosine kinase that has been shown to be a potent oncogene. The exact pathogenetic mechanisms leading to lymphomagenesis remain elusive; however, the synops","Age Factors, Anaplastic Lymphoma Kinase, Hodgkin Disease/genetics, Humans, Immunophenotyping, Lymphoma, Large B-Cell, Diffuse/diagnosis/epidemiology/*genetics/pathology, Nuclear Proteins/*genetics/physiology, Prognosis, Protein-Tyrosine Kinases/*genetics/physiology, Receptor Protein-","Drexler HG, Gignac SM, von Wasielewski R, Werner M, Dirks WG","Leukemia. 2000 Sep;14(9):1533-59. doi","2000 Sep","10.1038/sj.leu.2401878 [doi]","Leukemia"
"164","20809971","Genomic amplification of BCR/ABL1 and a region downstream of ABL1 in","BACKGROUND: Chronic myeloid leukaemia (CML) is characterized by the expression of the BCR/ABL1 fusion gene, a constitutively activated tyrosine kinase that commonly results from the formation of the Philadelphia (Ph) chromosome after a t(9;22)(q34;q11) or variant rearrangement. The duplication of the Ph chromosome is a recurring abnormality acquired during disease progression, whereas intrachromosomal amplification of BCR/ABL1 is a rare phenomenon and has been associated with imatinib therapy resistance. Archival bone marrow chromosome suspensions from 19 CML patients known to carry more than 1 copy of BCR/ABL1 and 10 CML cell lines were analyzed by fluorescent in situ hybridization with a panel of probes from 9q34.1-qter to investigate whether they carried two identical copies of the Ph chromosome or, instead, one or both Ph contained cryptic imbalances of some regions. RESULTS: A duplication ","?","Virgili A, Nacheva EP","Mol Cytogenet. 2010 Sep 1;3:15. doi","2010 Sep","1755-8166-3-15 [pii], 10.1186/1755-8166-3-15 [doi]","Molecular cytogenetics"
"165","12661006","Fusion of FIG to the receptor tyrosine kinase ROS in a glioblastoma ","The transmembrane proto-oncogene receptor tyrosine kinase (RTK) ROS is an orphan receptor that is aberrantly expressed in neoplasms of the central nervous system. Here, we report the fusion of its carboxy-terminal kinase domain to the amino-terminal portion of a protein called FIG (Fused in Glioblastoma) in a human glioblastoma multiforme (GBM). By characterizing both FIG and ROS genes in normal and in U118MG GBM cells, we determined that an intra-chromosomal homozygous deletion of 240 kilobases on 6q21 is responsible for the formation of the FIG-ROS locus. The FIG-ROS transcript is encoded by 7 FIG exons and 9 ROS-derived exons. We also demonstrate that the FIG-ROS locus encodes for an in-frame fusion protein with a constitutively active kinase activity, suggesting that FIG-ROS may act as an oncogene. This is the first example of a fusion RTK protein that results from an intra-chromosomal dele","Amino Acid Sequence, Animals, Base Sequence/genetics, COS Cells, Carrier Proteins/chemistry/*genetics/metabolism, Catalytic Domain/genetics, Chlorocebus aethiops, *Chromosome Deletion, Chromosome Mapping, Chromosomes, Human, Pair 6/*genetics, Glioblastoma/*enzymology/*genetics, Human","Charest A, Lane K, McMahon K, Park J, Preisinger E, Conroy H, Housman D","Genes Chromosomes Cancer. 2003 May;37(1):58-71. doi","2003 May","10.1002/gcc.10207 [doi]","Genes, chromosomes & cancer"
"166","30171048","Rare but Recurrent ROS1 Fusions Resulting From Chromosome 6q22 Micro","PURPOSE: Gliomas, a genetically heterogeneous group of primary central nervous system tumors, continue to pose a significant clinical challenge. Discovery of chromosomal rearrangements involving kinase genes has enabled precision therapy, and improved outcomes in several malignancies. EXPERIMENTAL DESIGN: Positing that similar benefit could be accomplished for patients with brain cancer, we evaluated The Cancer Genome Atlas (TCGA) glioblastoma dataset. Functional validation of the oncogenic potential and inhibitory sensitivity of discovered ROS1 fusions was performed using three independent cell-based model systems, and an in vivo murine xenograft study. RESULTS: In silico analysis revealed previously unreported intrachromosomal 6q22 microdeletions that generate ROS1-fusions from TCGA glioblastoma dataset. ROS1 fusions in primary glioma and ependymoma were independently corroborated from MSK-IM","Animals, Antineoplastic Agents/pharmacology/therapeutic use, Biomarkers, Tumor, Cell Line, Tumor, *Chromosome Deletion, *Chromosomes, Human, Pair 6, Disease Models, Animal, Gene Expression Regulation, Neoplastic, Glioma/diagnosis/*genetics/mortality/therapy, Humans, Mice, Molecular T","Davare MA, Henderson JJ, Agarwal A, Wagner JP, Iyer SR, Shah N, Woltjer R, Somwar R, Gilheeney SW, DeCarvalo A, Mikkelson T, Van Meir EG, Ladanyi M, Druker BJ","Clin Cancer Res. 2018 Dec 15;24(24):6471-6482. doi","2018 Dec","1078-0432.CCR-18-1052 [pii], 10.1158/1078-0432.CCR-18-1052 [doi]","Clinical cancer research"
"167","24469055","Oncogenic RIT1 mutations in lung adenocarcinoma.","Lung adenocarcinoma is comprised of distinct mutational subtypes characterized by mutually exclusive oncogenic mutations in RTK/RAS pathway members KRAS, EGFR, BRAF and ERBB2, and translocations involving ALK, RET and ROS1. Identification of these oncogenic events has transformed the treatment of lung adenocarcinoma via application of therapies targeted toward specific genetic lesions in stratified patient populations. However, such mutations have been reported in only approximately 55% of lung adenocarcinoma cases in the United States, suggesting other mechanisms of malignancy are involved in the remaining cases. Here we report somatic mutations in the small GTPase gene RIT1 in approximately 2% of lung adenocarcinoma cases that cluster in a hotspot near the switch II domain of the protein. RIT1 switch II domain mutations are mutually exclusive with all other known lung adenocarcinoma driver mu","Adenocarcinoma/*genetics/pathology, Animals, Antineoplastic Agents/pharmacology, Biomarkers, Tumor/genetics/metabolism, Cell Line, Tumor, Humans, Lung Neoplasms/*genetics/pathology, MAP Kinase Signaling System, Mice, Mice, Nude, Mutation, NIH 3T3 Cells, Neoplasms, Experimental, PC12 ","Berger AH, Imielinski M, Duke F, Wala J, Kaplan N, Shi GX, Andres DA, Meyerson M","Oncogene. 2014 Aug 28;33(35):4418-23. doi","2014 Aug","onc2013581 [pii], 10.1038/onc.2013.581 [doi]","Oncogene"
"168","20587502","Targeted next-generation sequencing of DNA regions proximal to a con","Tyrosine kinase (TK) fusions are attractive drug targets in cancers. However, rapid identification of these lesions has been hampered by experimental limitations. Our in silico analysis of known cancer-derived TK fusions revealed that most breakpoints occur within a defined region upstream of a conserved GXGXXG kinase motif. We therefore designed a novel DNA-based targeted sequencing approach to screen systematically for fusions within the 90 human TKs; it should detect 92% of known TK fusions. We deliberately paired 'in-solution' DNA capture with 454 sequencing to minimize starting material requirements, take advantage of long sequence reads, and facilitate mapping of fusions. To validate this platform, we analyzed genomic DNA from thyroid cancer cells (TPC-1) and leukemia cells (KG-1) with fusions known only at the mRNA level. We readily identified for the first time the genomic fusion sequen","Amino Acid Motifs, Cell Line, Tumor, Chromosome Breakpoints, Chromosome Mapping, Conserved Sequence, Cytoskeletal Proteins/genetics, Humans, Mutant Chimeric Proteins/*genetics, Neoplasm Proteins/*genetics, Protein-Tyrosine Kinases/*genetics, Proto-Oncogene Proteins c-ret/genetics, Re","Chmielecki J, Peifer M, Jia P, Socci ND, Hutchinson K, Viale A, Zhao Z, Thomas RK, Pao W","Nucleic Acids Res. 2010 Nov;38(20):6985-96. doi","2010 Nov","gkq579 [pii], 10.1093/nar/gkq579 [doi]","Nucleic acids research"
"169","26719536","Non-Small Cell Lung Cancer Cells Acquire Resistance to the ALK Inhib","Crizotinib is the standard of care for advanced non-small cell lung cancer (NSCLC) patients harboring the anaplastic lymphoma kinase (ALK) fusion gene, but resistance invariably develops. Unlike crizotinib, alectinib is a selective ALK tyrosine kinase inhibitor (TKI) with more potent antitumor effects and a favorable toxicity profile, even in crizotinib-resistant cases. However, acquired resistance to alectinib, as for other TKIs, remains a limitation of its efficacy. Therefore, we investigated the mechanisms by which human NSCLC cells acquire resistance to alectinib. We established two alectinib-resistant cell lines that did not harbor the secondary ALK mutations frequently occurring in crizotinib-resistant cells. One cell line lost the EML4-ALK fusion gene, but exhibited increased activation of insulin-like growth factor-1 receptor (IGF1R) and human epidermal growth factor receptor 3 (HER3), ","Anaplastic Lymphoma Kinase, Animals, Carcinoma, Non-Small-Cell Lung/drug therapy/*genetics, Cell Line, Tumor, Drug Resistance, Neoplasm/drug effects/*genetics, Female, Humans, Lung Neoplasms/drug therapy/*genetics, Mice, Mice, Inbred BALB C, Mice, Nude, Mutation/drug effects/genetics","Isozaki H, Ichihara E, Takigawa N, Ohashi K, Ochi N, Yasugi M, Ninomiya T, Yamane H, Hotta K, Sakai K, Matsumoto K, Hosokawa S, Bessho A, Sendo T, Tanimoto M, Kiura K","Cancer Res. 2016 Mar 15;76(6):1506-16. doi","2016 Mar","0008-5472.CAN-15-1010 [pii], 10.1158/0008-5472.CAN-15-1010 [doi]","Cancer research"
"170","15356659","Establishment of a novel anaplastic large-cell lymphoma-cell line (C","Anaplastic large-cell lymphoma (ALCL) is a distinct biological and cytogenetic entity with a broad spectrum of morphological features (common type, small-cell variant and lymphohistiocytic variant). Few cell lines of ALCL are available and they all originate from primary tumors demonstrating the common type morphology (ie large-sized lymphoma cells). We established a new ALCL cell line (COST) from the peripheral blood of a patient with a small-cell variant of ALCL, at diagnosis. Cells growing in vitro and in SCID mice consisted of two populations, that is, small- and large-sized cells as seen in the patient's tumor. Both large and small malignant cells were positive for CD43/MT1 T-cell associated antigen, perforin, granzyme B and TIA-1, but negative for CD2, CD3, CD5, CD7, CD4 and CD8 antigens. Standard cytogenetic studies as well as multiplex FISH confirmed the presence of the canonical t(2;5)","Animals, Antigens, CD/metabolism, Child, Preschool, Chromosome Aberrations, Chromosomes, Human, Pair 2/genetics, Chromosomes, Human, Pair 5/genetics, Cytogenetic Analysis, Female, Gene Rearrangement, T-Lymphocyte, Humans, Immunophenotyping, In Situ Hybridization, Fluorescence, In Vit","Lamant L, Espinos E, Duplantier M, Dastugue N, Robert A, Allouche M, Ragab J, Brousset P, Villalva C, Gascoyne RD, Al Saati T, Delsol G","Leukemia. 2004 Oct;18(10):1693-8. doi","2004 Oct","10.1038/sj.leu.2403464 [doi], 2403464 [pii]","Leukemia"
"171","27821800","Synergistic effects of selective inhibitors targeting the PI3K/AKT/m","Philadelphia chromosome-positive (Ph+) Acute Lymphoblastic Leukemia (ALL) accounts for 25-30% of adult ALL and its incidence increases with age in adults >40 years old. Irrespective of age, the ABL1 fusion genes are markers of poor prognosis and amplification of the NUP214-ABL1 oncogene can be detected mainly in patients with T-ALL. T cell malignancies harboring the ABL1 fusion genes are sensitive to many cytotoxic agents, but up to date complete remissions have not been achieved. The PI3K/Akt/mTOR signaling pathway is often activated in leukemias and plays a crucial role in leukemogenesis.We analyzed the effects of three BCR-ABL1 tyrosine kinase inhibitors (TKIs), alone and in combination with a panel of selective PI3K/Akt/mTOR inhibitors, on three NUP214-ABL1 positive T-ALL cell lines that also displayed PI3K/Akt/mTOR activation. Cells were sensitive to anti BCR-ABL1 TKIs Imatinib, Nilotinib ","Cell Line, Tumor, Drug Screening Assays, Antitumor, Drug Synergism, Humans, Imatinib Mesylate/pharmacology, Imidazoles/pharmacology, Molecular Targeted Therapy/methods, Nuclear Pore Complex Proteins/antagonists & inhibitors/*genetics, Oncogene Protein v-akt/antagonists & inhibitors/m","Simioni C, Ultimo S, Martelli AM, Zauli G, Milani D, McCubrey JA, Capitani S, Neri LM","Oncotarget. 2016 Nov 29;7(48):79842-79853. doi","2016 Nov","13035 [pii], 10.18632/oncotarget.13035 [doi]","Oncotarget"
"172","29967475","T315I mutation of BCR-ABL1 into human Philadelphia chromosome-positi","In many cancers, somatic mutations confer tumorigenesis and drug-resistance. The recently established clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system is a potentially elegant approach to functionally evaluate mutations in cancers. To reproduce mutations by homologous recombination (HR), the HR pathway must be functional, but DNA damage repair is frequently impaired in cancers. Imatinib is a tyrosine kinase inhibitor for BCR-ABL1 in Philadelphia chromosome-positive (Ph+) leukemia, and development of resistance due to kinase domain mutation is an important issue. We attempted to introduce the T315I gatekeeper mutation into three Ph+ myeloid leukemia cell lines with a seemingly functional HR pathway due to resistance to the inhibitor for poly (ADP) ribose polymerase1. Imatinib-resistant sublines were efficiently developed by the CRISPR/Cas9 system after short-term se","*CRISPR-Cas Systems, Cell Line, Tumor, Drug Resistance, Neoplasm/genetics, Fusion Proteins, bcr-abl/*genetics, *Homologous Recombination, Humans, Imatinib Mesylate/pharmacology, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/drug therapy/*genetics/pathology, *Mutation, ","Tamai M, Inukai T, Kojika S, Abe M, Kagami K, Harama D, Shinohara T, Watanabe A, Oshiro H, Akahane K, Goi K, Sugihara E, Nakada S, Sugita K","Sci Rep. 2018 Jul 2;8(1):9966. doi","2018 Jul","10.1038/s41598-018-27767-6 [doi], 10.1038/s41598-018-27767-6 [pii]","Scientific reports"
"173","27873490","EGF Induced RET Inhibitor Resistance in CCDC6-RET Lung Cancer Cells.","PURPOSE: Rearrangement of the proto-oncogene rearranged during transfection (RET) has been newly identified potential driver mutation in lung adenocarcinoma. Clinically available tyrosine kinase inhibitors (TKIs) target RET kinase activity, which suggests that patients with RET fusion genes may be treatable with a kinase inhibitor. Nevertheless, the mechanisms of resistance to these agents remain largely unknown. Thus, the present study aimed to determine whether epidermal growth factor (EGF) and hepatocyte growth factor (HGF) trigger RET inhibitor resistance in LC-2/ad cells with CCDC6-RET fusion genes. MATERIALS AND METHODS: The effects of EGF and HGF on the susceptibility of a CCDC6-RET lung cancer cell line to RET inhibitors (sunitinib, E7080, vandetanib, and sorafenib) were examined. RESULTS: CCDC6-RET lung cancer cells were highly sensitive to RET inhibitors. EGF activated epidermal growt","Adenocarcinoma/drug therapy/*genetics, Cell Line, Tumor, Cetuximab/pharmacology, Drug Resistance, Neoplasm/drug effects/*genetics, Epidermal Growth Factor/metabolism/*pharmacology, ErbB Receptors/genetics/metabolism, Gefitinib, *Gene Rearrangement, Hepatocyte Growth Factor/*pharmacol","Chang H, Sung JH, Moon SU, Kim HS, Kim JW, Lee JS","Yonsei Med J. 2017 Jan;58(1):9-18. doi","2017 Jan","58.9 [pii], 10.3349/ymj.2017.58.1.9 [doi]","Yonsei medical journal"
"174","26258416","Reversal of microRNA-150 silencing disadvantages crizotinib-resistan","The regulatory microRNA miR-150 is involved in the development of hemopathies and is downregulated in T-lymphomas, such as anaplastic large-cell lymphoma (ALCL) tumors. ALCL is defined by the presence or absence of translocations that activate the anaplastic lymphoma kinase (ALK), with nucleophosmin-ALK (NPM-ALK) fusions being the most common. Here, we compared samples of primary NPM-ALK(+) and NPM-ALK(-) ALCL to investigate the role of miR-150 downstream of NPM-ALK. Methylation of the MIR150 gene was substantially elevated in NPM-ALK(+) biopsies and correlated with reduced miR-150 expression. In NPM-ALK(+) cell lines, DNA hypermethylation-mediated miR-150 repression required ALK-dependent pathways, as ALK inhibition restored miR-150 expression. Moreover, epigenetic silencing of miR-150 was due to the activation of STAT3, a major downstream substrate of NPM-ALK, in cooperation with DNA methyltr","Animals, Cell Line, Tumor, Crizotinib, DNA (Cytosine-5-)-Methyltransferase 1, DNA (Cytosine-5-)-Methyltransferases/genetics/metabolism, *Drug Resistance, Neoplasm, Female, *Gene Expression Regulation, Neoplastic, *Gene Silencing, Humans, Lymphoma, Large-Cell, Anaplastic/drug therapy/","Hoareau-Aveilla C, Valentin T, Daugrois C, Quelen C, Mitou G, Quentin S, Jia J, Spicuglia S, Ferrier P, Ceccon M, Giuriato S, Gambacorti-Passerini C, Brousset P, Lamant L, Meggetto F","J Clin Invest. 2015 Sep;125(9):3505-18. doi","2015 Sep","78488 [pii], 10.1172/JCI78488 [doi]","The Journal of clinical investigation"
"175","26585927","Quantification of Anaplastic Lymphoma Kinase Protein Expression in N","BACKGROUND: Crizotinib has antitumor activity in ALK (anaplastic lymphoma receptor tyrosine kinase)-rearranged non-small cell lung cancer (NSCLC). The current diagnostic test for ALK rearrangement is breakapart fluorescence in situ hybridization (FISH), but FISH has low throughput and is not always reflective of protein concentrations. The emergence of multiple clinically relevant biomarkers in NSCLC necessitates efficient testing of scarce tissue samples. We developed an anaplastic lymphoma kinase (ALK) protein assay that uses multiplexed selected reaction monitoring (SRM) to quantify absolute amounts of ALK in formalin-fixed paraffin-embedded (FFPE) tumor tissue. METHODS: After validation in formalin-fixed cell lines, the SRM assay was used to quantify concentrations of ALK in 18 FFPE NSCLC samples that had been tested for ALK by FISH and immunohistochemistry. Results were correlated with pat","Anaplastic Lymphoma Kinase, Antineoplastic Agents/pharmacology/*therapeutic use, Carcinoma, Non-Small-Cell Lung/diagnosis/*drug therapy/genetics, Cell Line, Tumor, Crizotinib, *Gene Expression Regulation, Neoplastic/drug effects, Humans, Immunohistochemistry, In Situ Hybridization, F","Hembrough T, Liao WL, Hartley CP, Ma PC, Velcheti V, Lanigan C, Thyparambil S, An E, Monga M, Krizman D, Burrows J, Tafe LJ","Clin Chem. 2016 Jan;62(1):252-61. doi","2016 Jan","clinchem.2015.245860 [pii], 10.1373/clinchem.2015.245860 [doi]","Clinical chemistry"
"176","9305612","JURL-MK1 (c-kit(high)/CD30-/CD40-) and JURL-MK2 (c-kit(low)/CD30+/CD","Two novel cell lines (JURL-MK1 and JURL-MK2) have been established from the peripheral blood of a patient in the blastic phase of chronic myelogenous leukemia. The cells grow in a single cell suspension with doubling times of 48 h (JURL-MK1) and 72 h (JURL-MK2). Cytogenetic analysis has shown that JURL-MK1 is hypodiploid whereas JURL-MK2 is near triploid and that both cell lines retain t(9;22). Moreover, JURL-MK1 and JURL-MK2 have a bcr/abl-fused gene with the same junction found in the patient's fresh cells, and both cell lines express the b3/a2 type of hybrid bcr/abl mRNA. The morphology and immunophenotype of these cell lines are reminiscent of megakaryoblasts. In both lines, a limited but consistent percentage of cells expresses gpIIbIIIa (CD41a), gpIIIa (CD61) and CD36, with no expression of gplb (CD42b), glycophorin A, hemoglobin and CD34. Both cell lines are clearly positive for CD33, CD","Antigens, Surface/analysis, CD40 Antigens/analysis, Cell Differentiation/drug effects, Cells, Cultured, Chromosome Banding, DNA, Viral/analysis, Dimethyl Sulfoxide/pharmacology, Fusion Proteins, bcr-abl/genetics, *Hematopoiesis, Herpesvirus 4, Human/genetics, Humans, Immunophenotypin","Di Noto R, Luciano L, Lo Pardo C, Ferrara F, Frigeri F, Mercuro O, Lombardi ML, Pane F, Vacca C, Manzo C, Salvatore F, Rotoli B, Del Vecchio L","Leukemia. 1997 Sep;11(9):1554-64. doi","1997 Sep","10.1038/sj.leu.2400760 [doi]","Leukemia"
"177","25173427","Rationale for co-targeting IGF-1R and ALK in ALK fusion-positive lun","Crizotinib, a selective tyrosine kinase inhibitor (TKI), shows marked activity in patients whose lung cancers harbor fusions in the gene encoding anaplastic lymphoma receptor tyrosine kinase (ALK), but its efficacy is limited by variable primary responses and acquired resistance. In work arising from the clinical observation of a patient with ALK fusion-positive lung cancer who had an exceptional response to an insulin-like growth factor 1 receptor (IGF-1R)-specific antibody, we define a therapeutic synergism between ALK and IGF-1R inhibitors. Similar to IGF-1R, ALK fusion proteins bind to the adaptor insulin receptor substrate 1 (IRS-1), and IRS-1 knockdown enhances the antitumor effects of ALK inhibitors. In models of ALK TKI resistance, the IGF-1R pathway is activated, and combined ALK and IGF-1R inhibition improves therapeutic efficacy. Consistent with this finding, the levels of IGF-1R and","Anaplastic Lymphoma Kinase, Crizotinib, Female, Gene Knockdown Techniques, Humans, Insulin Receptor Substrate Proteins/genetics, Lung Neoplasms/*drug therapy/enzymology/metabolism, Middle Aged, Pyrazoles/pharmacology/*therapeutic use, Pyridines/pharmacology/*therapeutic use, Receptor","Lovly CM, McDonald NT, Chen H, Ortiz-Cuaran S, Heukamp LC, Yan Y, Florin A, Ozretic L, Lim D, Wang L, Chen Z, Chen X, Lu P, Paik PK, Shen R, Jin H, Buettner R, Ansen S, Perner S, Brockmann M, Bos M, Wolf J, Gardizi M, Wright GM, Solomon B, Russell PA, Rogers TM, Suehara Y, Red-Brewer M, Tieu R, de Stanchin","Nat Med. 2014 Sep;20(9):1027-34. doi","2014 Sep","nm.3667 [pii], 10.1038/nm.3667 [doi]","Nature medicine"
"178","29286485","Characterization of Tumor Cells Using a Medical Wire for Capturing C","Circulating tumor cells (CTCs) are associated with poor survival in metastatic cancer. Their identification, phenotyping, and genotyping could lead to a better understanding of tumor heterogeneity and thus facilitate the selection of patients for personalized treatment. However, this is hampered because of the rarity of CTCs. We present an innovative approach for sampling a high volume of the patient blood and obtaining information about presence, phenotype, and gene translocation of CTCs. The method combines immunofluorescence staining and DNA fluorescent-in-situ-hybridization (DNA FISH) and is based on a functionalized medical wire. This wire is an innovative device that permits the in vivo isolation of CTCs from a large volume of peripheral blood. The blood volume screened by a 30-min administration of the wire is approximately 1.5-3 L. To demonstrate the feasibility of this approach, epithe","Cell Line, Tumor, DNA/analysis, Fluorescent Antibody Technique/*methods, Humans, In Situ Hybridization, Fluorescence/*methods, Neoplasms/*blood/pathology, Neoplastic Cells, Circulating/*pathology","Gallerani G, Cocchi C, Bocchini M, Piccinini F, Fabbri F","J Vis Exp. 2017 Dec 21;(130). doi","2017 Dec","10.3791/56936 [doi]","Journal of visualized experiments"
"179","25874976","ALK kinase domain mutations in primary anaplastic large cell lymphom","ALK inhibitor crizotinib has shown potent antitumor activity in children with refractory Anaplastic Large Cell Lymphoma (ALCL) and the opportunity to include ALK inhibitors in first-line therapies is oncoming. However, recent studies suggest that crizotinib-resistance mutations may emerge in ALCL patients. In the present study, we analyzed ALK kinase domain mutational status of 36 paediatric ALCL patients at diagnosis to identify point mutations and gene aberrations that could impact on NPM-ALK gene expression, activity and sensitivity to small-molecule inhibitors. Amplicon ultra-deep sequencing of ALK kinase domain detected 2 single point mutations, R335Q and R291Q, in 2 cases, 2 common deletions of exon 23 and 25 in all the patients, and 7 splicing-related INDELs in a variable number of them. The functional impact of missense mutations and INDELs was evaluated. Point mutations were shown to a","Adolescent, Anaplastic Lymphoma Kinase, Animals, COS Cells, Child, Child, Preschool, Chlorocebus aethiops, Crizotinib, Drug Resistance, Neoplasm, Female, HEK293 Cells, Humans, INDEL Mutation, Infant, Lymphoma, Large-Cell, Anaplastic/drug therapy/*enzymology/*genetics, Male, Molecular","Lovisa F, Cozza G, Cristiani A, Cuzzolin A, Albiero A, Mussolin L, Pillon M, Moro S, Basso G, Rosolen A, Bonvini P","PLoS One. 2015 Apr 13;10(4):e0121378. doi","2015","10.1371/journal.pone.0121378 [doi], PONE-D-14-44557 [pii]","PloS one"
"180","28802831","Validation of a Targeted RNA Sequencing Assay for Kinase Fusion Dete","Kinase gene fusions are important drivers of oncogenic transformation and can be inhibited with targeted therapies. Clinical grade diagnostics using RNA sequencing to detect gene rearrangements in solid tumors are limited, and the few that are available require prior knowledge of fusion break points. To address this, we have analytically validated a targeted RNA sequencing assay (OSU-SpARKFuse) for fusion detection that interrogates complete transcripts from 93 kinase and transcription factor genes. From a total of 74 positive and 36 negative control samples, OSU-SpARKFuse had 93.3% sensitivity and 100% specificity for fusion detection. Assessment of repeatability and reproducibility revealed 96.3% and 94.4% concordance between intrarun and interrun technical replicates, respectively. Application of this assay on prospective patient samples uncovered OLFM4 as a novel RET fusion partner in a sma","Alternative Splicing, *Biomarkers, Tumor, Cell Line, Tumor, Gene Expression Profiling, Humans, In Situ Hybridization, Fluorescence, Neoplasms/*diagnosis/*genetics, Oncogene Proteins, Fusion/*genetics, Polymorphism, Single Nucleotide, Protein Kinases/*genetics, Proto-Oncogene Proteins","Reeser JW, Martin D, Miya J, Kautto EA, Lyon E, Zhu E, Wing MR, Smith A, Reeder M, Samorodnitsky E, Parks H, Naik KR, Gozgit J, Nowacki N, Davies KD, Varella-Garcia M, Yu L, Freud AG, Coleman J, Aisner DL, Roychowdhury S","J Mol Diagn. 2017 Sep;19(5):682-696. doi","2017 Sep","S1525-1578(17)30114-9 [pii], 10.1016/j.jmoldx.2017.05.006 [doi]","The Journal of molecular diagnostics"
"181","17252008","Phosphoproteomic analysis identifies the M0-91 cell line as a cellul","?","Acute Disease, Biomarkers, Tumor/*analysis/genetics, *Cell Line, Tumor/chemistry, Chromosomes, Human, Pair 12/genetics/ultrastructure, Chromosomes, Human, Pair 15/genetics/ultrastructure, Humans, Leukemia, Myeloid/genetics/*pathology, Neoplasm Proteins/*metabolism, Oncogene Proteins,","Gu TL, Popova L, Reeves C, Nardone J, Macneill J, Rush J, Nimer SD, Polakiewicz RD","Leukemia. 2007 Mar;21(3):563-6. doi","2007 Mar","2404555 [pii], 10.1038/sj.leu.2404555 [doi]","Leukemia"
"182","24022839","Native and rearranged ALK copy number and rearranged cell count in n","BACKGROUND: Patients with anaplastic lymphoma kinase (ALK)-positive non-small cell lung cancer (NSCLC) respond to ALK inhibitors. Clinically, the presence of >/=15% cells with rearrangements identified on break-apart fluorescence in situ hybridization (FISH) classifies tumors as positive. Increases in native and rearranged ALK copy number also occur. METHODS: In total, 1426 NSCLC clinical specimens (174 ALK-positive specimens and 1252 ALK-negative specimens) and 24 ALK-negative NSCLC cell lines were investigated. ALK copy number and genomic status were assessed by FISH. RESULTS: Clinical specimens with 0% to 9%, 10% to 15%, 16% to 30%, 31% to 50%, and >50% ALK-positive cells were identified in 79.3%, 8.5%, 1.4%, 2.7%, and 8.1%, respectively. An increased native ALK copy number (>/=3 copies per cell in >/=40% of cells) was detected in 19% of ALK-positive tumors and in 62% of ALK-negative tumors.","Anaplastic Lymphoma Kinase, Carcinoma, Non-Small-Cell Lung/*drug therapy/*enzymology/genetics, Cell Line, Tumor, Crizotinib, DNA Copy Number Variations, Disease-Free Survival, Gene Rearrangement, Humans, In Situ Hybridization, Fluorescence, Lung Neoplasms/*drug therapy/*enzymology/ge","Camidge DR, Skokan M, Kiatsimkul P, Helfrich B, Lu X, Baron AE, Schulte N, Maxson D, Aisner DL, Franklin WA, Doebele RC, Varella-Garcia M","Cancer. 2013 Nov 15;119(22):3968-75. doi","2013 Nov","10.1002/cncr.28311 [doi]","Cancer"
"183","28011461","Antitumor Activity of RXDX-105 in Multiple Cancer Types with RET Rea","Purpose: While multikinase inhibitors with RET activity are active in RET-rearranged thyroid and lung cancers, objective response rates are relatively low and toxicity can be substantial. The development of novel RET inhibitors with improved potency and/or reduced toxicity is thus an unmet need. RXDX-105 is a small molecule kinase inhibitor that potently inhibits RET. The purpose of the preclinical and clinical studies was to evaluate the potential of RXDX-105 as an effective therapy for cancers driven by RET alterations.Experimental design: The RET-inhibitory activity of RXDX-105 was assessed by biochemical and cellular assays, followed by in vivo tumor growth inhibition studies in cell line- and patient-derived xenograft models. Antitumor activity in patients was assessed by imaging and Response Evaluation Criteria in Solid Tumors (RECIST).Results: Biochemically, RXDX-105 inhibited wild-type ","Animals, Cell Line, Tumor, Cell Proliferation/*drug effects, Cell Survival/drug effects, Gene Rearrangement/drug effects, Humans, Mice, Mutation, Neoplasm Proteins/antagonists & inhibitors, Neoplasms/*drug therapy/genetics/pathology, Protein Kinase Inhibitors/*administration & dosage","Li GG, Somwar R, Joseph J, Smith RS, Hayashi T, Martin L, Franovic A, Schairer A, Martin E, Riely GJ, Harris J, Yan S, Wei G, Oliver JW, Patel R, Multani P, Ladanyi M, Drilon A","Clin Cancer Res. 2017 Jun 15;23(12):2981-2990. doi","2017 Jun","1078-0432.CCR-16-1887 [pii], 10.1158/1078-0432.CCR-16-1887 [doi]","Clinical cancer research"
"184","16049513","Prevalence and clinical implications of bone marrow involvement in p","Anaplastic large cell lymphoma (ALCL) harbors the reciprocal chromosomal translocation t(2;5)(p23;q35) in approximately 80% of the cases. The genes involved are nucleophosmin (NPM) and anaplastic lymphoma kinase (ALK) and the resulting chimeric NPM-ALK protein is thought to play a key role in the pathogenesis of t(2;5) positive ALCL. Few data on bone marrow (BM) involvement in ALCL have been published and they mostly rely on morphological examination of BM smears. We studied 52 ALCL for NPM-ALK expression by RT-PCR: 47/52 biopsies were positive. In 41 of the 47 cases we obtained the BM at diagnosis and investigated the prevalence of minimal BM infiltration by RT-PCR and real-time PCR. Minimal disseminated disease was positive in 25/41 patients (61%), of whom six had morphologically infiltrated BM. Survival analysis demonstrated a 5-year progression-free survival of 41 +/- 11% for patients with ","Adolescent, Bone Marrow/*metabolism/pathology, Child, Child, Preschool, Female, Gene Expression Regulation, Neoplastic, Humans, Infant, Lymphoma, Large B-Cell, Diffuse/*diagnosis/*genetics/metabolism, Male, Neoplasm, Residual, Nuclear Proteins/genetics, Prospective Studies, Protein-T","Mussolin L, Pillon M', ""d'Amore ES"", 'Santoro N, Lombardi A, Fagioli F, Zanesco L, Rosolen A","Leukemia. 2005 Sep;19(9):1643-7. doi","2005 Sep","2403888 [pii], 10.1038/sj.leu.2403888 [doi]","Leukemia"
"185","29304828","Oncogene addiction and radiation oncology","BACKGROUND: Patients with Echinoderm microtubule-associated protein-like 4 (EML4)-anaplastic lymphoma kinase (ALK) positive lung cancer are sensitive to ALK-kinase inhibitors. TAE684 is a potent second generation ALK inhibitor that overcomes Crizotinib resistance. Radiotherapy is an integral therapeutic component of locally advanced lung cancer. Therefore, we sought to investigate the effects of combined radiotherapy and ALK-inhibition via TAE684 in ALK-positive vs. wild type lung cancer cells. METHODS: Human non-small cell lung cancer (NSCLC) cell lines harboring wild-type ALK (A549), EML4-ALK translocation (H3122) and murine Lewis Lung Cancer (LLC) cells were investigated. Cells were irradiated with 1-4 Gy X-Rays (320 keV) and carbon ions (Spread-out Bragg Peak, SOBP (245.4-257.0 MeV/u)) at Heidelberg Ion Therapy center. TAE684 was administered at the dose range 0-100 nM. Clonogenic survival,","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/pharmacology, Apoptosis/drug effects/radiation effects, Carcinoma, Lewis Lung, *Carcinoma, Non-Small-Cell Lung/genetics, Cell Cycle Proteins/genetics, Cell Line, Tumor, Cell Proliferation/drug effects/radiation effects, Cell ","Dai Y, Wei Q, Schwager C, Hanne J, Zhou C, Herfarth K, Rieken S, Lipson KE, Debus J, Abdollahi A","Radiat Oncol. 2018 Jan 5;13(1):1. doi","2018 Jan","10.1186/s13014-017-0947-0 [doi], 10.1186/s13014-017-0947-0 [pii]","Radiation oncology (London, England)"
"186","26133723","Silibinin suppresses NPM-ALK, potently induces apoptosis and enhance","Nucleophosmin-anaplastic lymphoma kinase (NPM-ALK), an oncogenic fusion protein carrying constitutively active tyrosine kinase, is known to be central to the pathogenesis of ALK-positive anaplastic large cell lymphoma (ALK+ALCL). Here, it is reported that silibinin, a non-toxic naturally-occurring compound, potently suppressed NPM-ALK and effectively inhibited the growth and soft agar colony formation of ALK+ALCL cells. By western blots, it was found that silibinin efficiently suppressed the phosphorylation/activation of NPM-ALK and its key substrates/downstream mediators (including STAT3, MEK/ERK and Akt) in a time- and dose-dependent manner. Correlating with these observations, silibinin suppressed the expression of Bcl-2, survivin and JunB, all of which are found to be upregulated by NPM-ALK and pathogenetically important in ALK+ALCL. Lastly, silibinin augmented the chemosensitivity of ALK+A","Anaplastic Lymphoma Kinase, Apoptosis/*drug effects/*genetics, Cell Cycle Checkpoints/drug effects, Cell Line, Tumor, Cell Proliferation/drug effects, Cell Transformation, Neoplastic/drug effects/genetics/metabolism, Doxorubicin/pharmacology, Drug Resistance, Neoplasm/*genetics, Drug","Molavi O, Samadi N, Wu C, Lavasanifar A, Lai R","Leuk Lymphoma. 2016 May;57(5):1154-62. doi","2016 May","10.3109/10428194.2015.1068306 [doi]","Leukemia & lymphoma"
"187","23637631","Breakpoint analysis of transcriptional and genomic profiles uncovers","Gene fusions, like BCR/ABL1 in chronic myelogenous leukemia, have long been recognized in hematologic and mesenchymal malignancies. The recent finding of gene fusions in prostate and lung cancers has motivated the search for pathogenic gene fusions in other malignancies. Here, we developed a ""breakpoint analysis"" pipeline to discover candidate gene fusions by tell-tale transcript level or genomic DNA copy number transitions occurring within genes. Mining data from 974 diverse cancer samples, we identified 198 candidate fusions involving annotated cancer genes. From these, we validated and further characterized novel gene fusions involving ROS1 tyrosine kinase in angiosarcoma (CEP85L/ROS1), SLC1A2 glutamate transporter in colon cancer (APIP/SLC1A2), RAF1 kinase in pancreatic cancer (ATG7/RAF1) and anaplastic astrocytoma (BCL6/RAF1), EWSR1 in melanoma (EWSR1/CREM), CDK6 kinase in T-cell acute lym","*Gene Fusion, Genomics, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics, Oncogene Proteins, Fusion/genetics, *Protein-Tyrosine Kinases/genetics, Proto-Oncogene Proteins/genetics","Giacomini CP, Sun S, Varma S, Shain AH, Giacomini MM, Balagtas J, Sweeney RT, Lai E, Del Vecchio CA, Forster AD, Clarke N, Montgomery KD, Zhu S, Wong AJ, van de Rijn M, West RB, Pollack JR","PLoS Genet. 2013 Apr;9(4):e1003464. doi","2013 Apr","10.1371/journal.pgen.1003464 [doi], PGENETICS-D-12-02993 [pii]","PLoS genetics"
"188","23325296","ALK inhibitors","The anaplastic lymphoma kinase (ALK) fusion gene is a key oncogenic driver in a subset of patients with advanced non-small cell lung cancer (NSCLC). Oncogenic fusion genes, including echinoderm microtubule-associated protein-like 4 (EML4) and ALK, have been detected in approximately 2-7 % of NSCLC patients. Fluorescence in situ hybridization (FISH) is the recommended method for detecting ALK gene rearrangement. EML4-ALK fusion genes define a molecular subset of NSCLC with distinct clinical characteristic (lung adenocarcinoma, never or former smoker, usually mutually exclusive with EGFR mutations). Crizotinib (PF-02341066) is an orally bioavailable, ATP-competitive, small molecule inhibitor of both the receptor tyrosine kinases ALK and c-MET (hepatocyte growth factor receptor). Crizotinib has been shown to yield important clinical benefit such as objective response rate, progression-free surviva","Anaplastic Lymphoma Kinase, Carcinoma, Non-Small-Cell Lung/*drug therapy/enzymology/genetics/pathology, Clinical Trials, Phase II as Topic, Crizotinib, Humans, Lung Neoplasms/*drug therapy/enzymology/genetics/pathology, Protein Kinase Inhibitors/administration & dosage/*therapeutic u","Casaluce F, Sgambato A, Maione P, Rossi A, Ferrara C, Napolitano A, Palazzolo G, Ciardiello F, Gridelli C","Target Oncol. 2013 Mar;8(1):55-67. doi","2013 Mar","10.1007/s11523-012-0250-9 [doi]","Targeted oncology"
"189","24334603","Gambogic acid induces apoptosis in imatinib-resistant chronic myeloi","PURPOSE: Chronic myelogenous leukemia (CML) is characterized by the constitutive activation of Bcr-Abl tyrosine kinase. Bcr-Abl-T315I is the predominant mutation that causes resistance to imatinib, cytotoxic drugs, and the second-generation tyrosine kinase inhibitors. The emergence of imatinib resistance in patients with CML leads to searching for novel approaches to the treatment of CML. Gambogic acid, a small molecule derived from Chinese herb gamboges, has been approved for phase II clinical trial for cancer therapy by the Chinese Food and Drug Administration (FDA). In this study, we investigated the effect of gambogic acid on cell survival or apoptosis in CML cells bearing Bcr-Abl-T315I or wild-type Bcr-Abl. EXPERIMENTAL DESIGN: CML cell lines (KBM5, KBM5-T315I, and K562), primary cells from patients with CML with clinical resistance to imatinib, and normal monocytes from healthy volunteers","Animals, Antineoplastic Agents, Phytogenic/*pharmacology, Apoptosis/*drug effects, Benzamides/*pharmacology, Caspases/metabolism, Cell Proliferation, Down-Regulation/drug effects, Drug Resistance, Neoplasm, Enzyme Activation, Female, Fusion Proteins, bcr-abl/*genetics/metabolism, Gen","Shi X, Chen X, Li X, Lan X, Zhao C, Liu S, Huang H, Liu N, Liao S, Song W, Zhou P, Wang S, Xu L, Wang X, Dou QP, Liu J","Clin Cancer Res. 2014 Jan 1;20(1):151-63. doi","2014 Jan","1078-0432.CCR-13-1063 [pii], 10.1158/1078-0432.CCR-13-1063 [doi]","Clinical cancer research"
"190","26476082","SUMOylation Confers Posttranslational Stability on NPM-ALK Oncogenic","Nucleophosmin-anaplastic lymphoma kinase-expressing (NPM-ALK+) T-cell lymphoma is an aggressive form of cancer that commonly affects children and adolescents. The expression of NPM-ALK chimeric oncogene results from the chromosomal translocation t(2;5)(p23;q35) that causes the fusion of the ALK and NPM genes. This translocation generates the NPM-ALK protein tyrosine kinase that forms the constitutively activated NPM-ALK/NPM-ALK homodimers. In addition, NPM-ALK is structurally associated with wild-type NPM to form NPM/NPM-ALK heterodimers, which can translocate to the nucleus. The mechanisms that sustain the stability of NPM-ALK are not fully understood. SUMOylation is a posttranslational modification that is characterized by the reversible conjugation of small ubiquitin-like modifiers (SUMOs) with target proteins. SUMO competes with ubiquitin for substrate binding and therefore, SUMOylation is ","Humans, Jurkat Cells, Lymphoma, T-Cell/genetics/*metabolism, Oncogene Proteins, Fusion/genetics/*metabolism, Protein Processing, Post-Translational/*physiology, Protein Stability, Protein-Tyrosine Kinases/genetics/*metabolism, Sumoylation/*physiology","Vishwamitra D, Curry CV, Shi P, Alkan S, Amin HM","Neoplasia. 2015 Sep;17(9):742-754. doi","2015 Sep","S1476-5586(15)00118-9 [pii], 10.1016/j.neo.2015.09.005 [doi]","Neoplasia (New York, N.Y.)"
"191","25384172","A mass spectrometry assay to simultaneously analyze ROS1 and RET fus","INTRODUCTION: ROS1 and RET gene fusions were recently discovered in non-small-cell lung cancer (NSCLC) as potential therapeutic targets with small-molecule kinase inhibitors. The conventional screening methods of these fusions are time-consuming and require samples of high quality and quantity. Here, we describe a novel and efficient method by coupling the power of multiplexing polymerase chain reaction and the sensitivity of mass spectrometry. METHODS: The multiplex mass spectrometry platform simultaneously tests samples for the expression of nine ROS1 and six RET fusion genes. The assay incorporates detection of wild-type exon junctions immediately upstream and downstream of the fusion junction to exclude false-negative results. To flag false-positives, the system also comprises two independent assays for each fusion gene junction. RESULTS: The characteristic mass spectrometric peaks of the g","Carcinoma, Non-Small-Cell Lung/*genetics/metabolism/pathology, Cell Line, Tumor, Cell Proliferation/physiology, Gene Expression, Humans, Lung Neoplasms/*genetics/metabolism/pathology, Mass Spectrometry, Oncogene Proteins, Fusion/biosynthesis/*genetics, Protein-Tyrosine Kinases/biosyn","Wijesinghe P, Bepler G, Bollig-Fischer A","J Thorac Oncol. 2015 Feb;10(2):381-6. doi","2015 Feb","10.1097/JTO.0000000000000337 [doi], S1556-0864(15)32343-1 [pii]","Journal of thoracic oncology"
"192","28806414","Alpha-tocopherol attenuates the anti-tumor activity of crizotinib ag","Anaplastic large cell lymphomas (ALCL) are mainly characterized by harboring the fusion protein nucleophosmin-anaplastic lymphoma kinase (NPM-ALK). The ALK inhibitor, crizotinib specifically induced apoptosis in Ba/F3 cells expressing NPM-ALK by inhibiting the activation of NPM-ALK and its downstream molecule, signal transducer and activator of transcription factor 3 (STAT3). We found that alpha-tocopherol, a major component of vitamin E, attenuated the effects of crizotinib independently of its anti-oxidant properties. Although alpha-tocopherol suppressed the inhibitory effects of crizotinib on the signaling axis including NPM-ALK and STAT3, it had no influence on the intake of crizotinib into cells. Crizotinib also directly inhibited the kinase activity of NPM-ALK; however, this inhibitory effect was not altered by the co-treatment with alpha-tocopherol. Whereas the nuclear localization of NP","Animals, Antineoplastic Agents/*pharmacology, Apoptosis/drug effects, Cell Line, Cell Line, Transformed, Cell Line, Tumor, Cell Nucleus/drug effects/metabolism, Crizotinib, Female, Humans, Lymphoma, Large-Cell, Anaplastic/metabolism, Mice, Nude, Phosphorylation/drug effects, Protein-","Uchihara Y, Ueda F, Tago K, Nakazawa Y, Ohe T, Mashino T, Yokota S, Kasahara T, Tamura H, Funakoshi-Tago M","PLoS One. 2017 Aug 14;12(8):e0183003. doi","2017","10.1371/journal.pone.0183003 [doi], PONE-D-17-18883 [pii]","PloS one"
"193","10576511","ABL-BCR expression in BCR-ABL-positive human leukemia cell lines.","Expression of normal ABL and BCR and of reciprocal fusion genes BCR-ABL and ABL-BCR was examined in a panel of 53 BCR-ABL-positive cell lines by RT-PCR to determine the influence of the various transcripts on leukemogenesis. Seventeen out of 18 lymphoid cell lines expressed ABL1a and/or ABL1b, whereas only 16 out of 35 myeloid cell lines expressed one or both normal ABL transcripts. Normal BCR was expressed in seven lymphoid cell lines; all cell lines from the m-bcr group (n = 9) were BCR-negative. Among the myeloid cell lines, 77% expressed the BCR gene. The M-bcr and m-bcr translocations were equally distributed among cell lines with lymphoid phenotype. The m-bcr translocation was not found in myeloid cell lines. b3-a2 constitutes the predominant form of fusion gene in myeloid cell lines with an incidence of about 68%. One myeloid cell line exhibited the mu-bcr variant. An ABL-BCR transcript ","Base Sequence, DNA Primers, Fusion Proteins, bcr-abl/*genetics, Humans, Leukemia/*genetics/pathology, RNA, Messenger/genetics, Reverse Transcriptase Polymerase Chain Reaction, Tumor Cells, Cultured","Uphoff CC, Habig S, Fombonne S, Matsuo Y, Drexler HG","Leuk Res. 1999 Nov;23(11):1055-60. doi","1999 Nov","S0145-2126(99)00131-9 [pii], 10.1016/s0145-2126(99)00131-9 [doi]","Leukemia research"
"194","26216294","An Oncogenic NTRK Fusion in a Patient with Soft-Tissue Sarcoma with ","UNLABELLED: Oncogenic TRK fusions induce cancer cell proliferation and engage critical cancer-related downstream signaling pathways. These TRK fusions occur rarely, but in a diverse spectrum of tumor histologies. LOXO-101 is an orally administered inhibitor of the TRK kinase and is highly selective only for the TRK family of receptors. Preclinical models of LOXO-101 using TRK-fusion-bearing human-derived cancer cell lines demonstrate inhibition of the fusion oncoprotein and cellular proliferation in vitro, and tumor growth in vivo. The tumor of a 41-year-old woman with soft-tissue sarcoma metastatic to the lung was found to harbor an LMNA-NTRK1 gene fusion encoding a functional LMNA-TRKA fusion oncoprotein as determined by an in situ proximity ligation assay. In a phase I study of LOXO-101 (ClinicalTrials.gov no. NCT02122913), this patient's tumors underwent rapid and substantial tumor regressi","Adult, Antineoplastic Agents/pharmacology/*therapeutic use, Cell Line, Tumor, Cell Proliferation/drug effects, Cell Transformation, Neoplastic/genetics, Dose-Response Relationship, Drug, Female, Humans, Lamin Type A/genetics, Neoplasm Staging, Oncogene Proteins/antagonists & inhibito","Doebele RC, Davis LE, Vaishnavi A, Le AT, Estrada-Bernal A, Keysar S, Jimeno A, Varella-Garcia M, Aisner DL, Li Y, Stephens PJ, Morosini D, Tuch BB, Fernandes M, Nanda N, Low JA","Cancer Discov. 2015 Oct;5(10):1049-57. doi","2015 Oct","2159-8290.CD-15-0443 [pii], 10.1158/2159-8290.CD-15-0443 [doi]","Cancer discovery"
"195","25873174","Convergent mutations and kinase fusions lead to oncogenic STAT3 acti","A systematic characterization of the genetic alterations driving ALCLs has not been performed. By integrating massive sequencing strategies, we provide a comprehensive characterization of driver genetic alterations (somatic point mutations, copy number alterations, and gene fusions) in ALK(-) ALCLs. We identified activating mutations of JAK1 and/or STAT3 genes in approximately 20% of 88 [corrected] ALK(-) ALCLs and demonstrated that 38% of systemic ALK(-) ALCLs displayed double lesions. Recurrent chimeras combining a transcription factor (NFkB2 or NCOR2) with a tyrosine kinase (ROS1 or TYK2) were also discovered in WT JAK1/STAT3 ALK(-) ALCL. All these aberrations lead to the constitutive activation of the JAK/STAT3 pathway, which was proved oncogenic. Consistently, JAK/STAT3 pathway inhibition impaired cell growth in vitro and in vivo.","Activating Transcription Factor 3/genetics/metabolism, Animals, Cell Line, Tumor, *Gene Expression Regulation, Neoplastic, HEK293 Cells, Humans, Janus Kinase 1/genetics, Lymphoma, Large-Cell, Anaplastic/*genetics, Mice, Mutant Chimeric Proteins/genetics/metabolism, NF-kappa B/genetic","Crescenzo R, Abate F, Lasorsa E', ""Tabbo' F"", 'Gaudiano M, Chiesa N, Di Giacomo F, Spaccarotella E, Barbarossa L, Ercole E, Todaro M, Boi M, Acquaviva A, Ficarra E, Novero D, Rinaldi A, Tousseyn T, Rosenwald A, Kenner L, Cerroni L, Tzankov A, Ponzoni M, Paulli M, Weisenburger D, Chan WC, Iqbal J, Piris MA'","Cancer Cell. 2015 Apr 13;27(4):516-32. doi","2015 Apr","S1535-6108(15)00094-X [pii], 10.1016/j.ccell.2015.03.006 [doi]","Cancer cell"
"196","12015767","Neutrophilic-chronic myeloid leukemia","BACKGROUND: Neutrophilic-chronic myeloid leukemia (CML-N) has been described as a CML variant associated both with a distinctive molecular defect of the Philadelphia chromosome and with a more benign clinical course than classic CML. The translocation (9;22) in CML-N results in the transcription of an e19/a2 type BCR/ABL mRNA that codes for a 230-kD BCR/ABL protein (p230). The indolence of the clinical course of patients with CML-N has been disputed. METHODS: The objectives of this study were to quantify and correlate with clinical outcome the p230 mRNA and protein in patients with CML-N, to describe six new patients and the follow-up (with molecular analysis) of five previously reported patients with CML-N, and to review characteristics of all patients with CML-N and p230 BCR/ABL reported to date in the literature. RESULTS: Quantitative polymerase chain reaction assays on specimens from the gr","Adult, Aged, Blotting, Western, Cell Line, Female, Follow-Up Studies, Fusion Proteins, bcr-abl/genetics, Humans, Leukemia, Neutrophilic, Chronic/*genetics/*physiopathology, Male, Middle Aged, Peptides/*genetics, *Philadelphia Chromosome, Polymerase Chain Reaction, RNA, Messenger/anal","Verstovsek S, Lin H, Kantarjian H, Saglio G, De Micheli D, Pane F, Garcia-Manero G, Intrieri M, Rotoli B, Salvatore F, Guo JQ, Talpaz M, Specchia G, Pizzolo G, Liberati AM, Cortes J, Quackenbush RC, Arlinghaus RB","Cancer. 2002 May 1;94(9):2416-25. doi","2002 May","10.1002/cncr.10490 [doi]","Cancer"
"197","16169003","Evaluation of CML model cell lines and imatinib mesylate response","Our understanding of the mechanisms by which BCR-ABL drives CML is based, in part, on the use of model cell lines such as the K562 cell line. However, the BCR-ABL translocation may occur via a number of different junction points. In addition, CML is a disease of hematopoietic stem cells and, as a result, can give rise to multiple lineages of tumor cells. In this study, we examined the cellular signaling profiles following imatinib mesylate treatment of eight model CML and ALL cell lines that encompass three BCR-ABL junction points and multiple lineages. We used phosphorylation-specific antibodies and flow cytometry to determine the kinase and pathway activation states with each of the cell lines before and after imatinib mesylate exposure. The comparisons of signaling response profiles, junction points and lineages indicate that cell line lineage rather than BCR-ABL junction point may determine","Animals, Benzamides, *Cell Line, Tumor, Fusion Proteins, bcr-abl/*antagonists & inhibitors/genetics, Humans, Imatinib Mesylate, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/metabolism, Neoplasm Proteins/*metabolism, Phosphorylation, Piperazines/*pharmacology, Protein Ki","Wetzel R, Goss VL, Norris B, Popova L, Melnick M, Smith BL","J Immunol Methods. 2005 Oct 20;305(1):59-66. doi","2005 Oct","S0022-1759(05)00226-7 [pii], 10.1016/j.jim.2005.07.012 [doi]","Journal of immunological methods"
"198","28639894","Deregulated expression of Cdc6 as BCR/ABL-dependent survival factor ","Chronic myeloid leukemia is characterized by the presence of the reciprocal translocation t(9;22) and the BCR/ABL oncogene. The BCR/ABL oncogene activates multiple signaling pathways and involves the dysregulation of oncogenes during the progression of chronic myeloid leukemia. The cell division cycle protein 6, an essential regulator of DNA replication, is elevated in some human cancer cells. However, the expression of cell division cycle protein 6 in chronic myeloid leukemia and the underlying regulatory mechanism remain to be elucidated. In this study, our data showed that cell division cycle protein 6 expression was significantly upregulated in primary chronic myeloid leukemia cells and the chronic myeloid leukemia cell line K562 cells, as compared to the normal bone marrow mononuclear cells. BCR/ABL kinase inhibitor STI571 or BCR/ABL small interfering RNA could significantly downregulate c","Apoptosis/drug effects, Benzamides/administration & dosage, Cell Cycle Proteins/*biosynthesis/genetics, Cell Division/*drug effects, Fusion Proteins, bcr-abl/*genetics, Gene Expression Regulation, Neoplastic/drug effects, Humans, Imatinib Mesylate/administration & dosage, K562 Cells,","Zhang JH, He YL, Zhu R, Du W, Xiao JH","Tumour Biol. 2017 Jun;39(6):1010428317713394. doi","2017 Jun","10.1177/1010428317713394 [doi]","Tumour biology"
"199","26716414","NTRK1 fusions for the therapeutic intervention of Korean patients wi","The identification and clinical validation of cancer driver genes are essential to accelerate the translational transition of cancer genomics, as well as to find clinically confident targets for the therapeutic intervention of cancers. Here we identified recurrent LMNA-NTRK1 and TPM3-NTRK1 fusions in Korean patients with colon cancer (3 out of 147, 2%) through next-generation RNA sequencing (RNA-seq). NTRK1 fusions were mutually exclusive oncogenic drivers of colon cancer that were accompanied with in vitro potential of colony formation and in vivo tumorigenicity comparable to KM12, a human colon cancer cell line harboring TPM3-NTRK1 fusion. NTRK1-encoded TrkA protein was prevalent in 11 out of 216 Korean (5.1%) and 28 out of 472 Chinese patients (5.9%) from independent cohorts, respectively. The expression level of TrkA was significantly correlated with NTRK1 fusion (p = 0.0192), which was ver","Aged, Animals, Carbazoles/pharmacology, Carcinogenesis, Case-Control Studies, Colonic Neoplasms/*drug therapy/*genetics/pathology, Crizotinib, Female, Follow-Up Studies, Gene Fusion, High-Throughput Nucleotide Sequencing, Humans, Immunoenzyme Techniques, In Situ Hybridization, Fluore","Park DY, Choi C, Shin E, Lee JH, Kwon CH, Jo HJ, Kim HR, Kim HS, Oh N, Lee JS, Park OK, Park E, Park J, Shin JY, Kim JI, Seo JS, Park HD, Park J","Oncotarget. 2016 Feb 16;7(7):8399-412. doi","2016 Feb","6724 [pii], 10.18632/oncotarget.6724 [doi]","Oncotarget"
"200","28338290","Identification of natural inhibitors of Bcr-Abl for the treatment of","Chronic myeloid leukemia (CML) is a clonal myeloproliferative disorder of the hematopoietic stem cells, characterized at the molecular level by the bcr/abl gene rearrangement. Even though targeting the fusion gene product Bcr-Abl protein is a successful strategy, development of drug resistance and that of drug intolerance are currently the limitations for Bcr-Abl-targeted CML therapy. With an aim to develop natural Bcr-Abl inhibitors, we performed virtual screening (VS) of ZINC natural compound database by docking with Abl kinase using Glide software. Two natural inhibitors ZINC08764498 (hit1) and ZINC12891610 (hit2) were selected by considering their high Glide docking score and critical interaction with the hinge region residue Met-318 of Abl kinase. The reactivity of the two molecules was assessed computationally by density functional theory calculations. Further, the conformational transiti","Apoptosis/drug effects, Biological Products/*chemistry/*pharmacology, Cell Line, Tumor, Cell Proliferation/drug effects, Cell Survival/drug effects, Drug Discovery, Fusion Proteins, bcr-abl/*antagonists & inhibitors/metabolism, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive","Parcha P, Sarvagalla S, Madhuri B, Pajaniradje S, Baskaran V, Coumar MS, Rajasekaran B","Chem Biol Drug Des. 2017 Oct;90(4):596-608. doi","2017 Oct","10.1111/cbdd.12983 [doi]","Chemical biology & drug design"
"201","27189703","Next-generation sequencing identifies a novel ELAVL1-TYK2 fusion gen","?","Biphenyl Compounds/*therapeutic use, Cell Line, Tumor, Drug Resistance, Neoplasm/genetics, ELAV-Like Protein 1/*genetics, Gene Expression Regulation, Leukemic/drug effects, High-Throughput Nucleotide Sequencing, Humans, Leukemia, Myeloid, Acute/*drug therapy/*genetics/pathology, Onco","Tron AE, Keeton EK, Ye M, Casas-Selves M, Chen H, Dillman KS, Gale RE, Stengel C, Zinda M, Linch DC, Lai Z, Khwaja A, Huszar D","Leuk Lymphoma. 2016 Dec;57(12):2927-2929. doi","2016 Dec","10.3109/10428194.2016.1171861 [doi]","Leukemia & lymphoma"
"202","23788109","Additive antileukemia effects by GFI1B- and BCR-ABL-specific siRNA i","Previous studies demonstrated selective inhibition of the BCR-ABL (breakpoint cluster region-Abelson murine leukemia oncogene) tyrosine kinase by RNA interference in leukemic cells. In this study, we evaluated the effect of BCR-ABL small interfering RNA (siRNA) and GFI1B siRNA silencing on chronic myeloid leukemia (CML) cells in myeloid blast crises. The GFI1B gene was mapped to chromosome 9 and is, therefore, located downstream of the BCR-ABL translocation in CML cells. Co-transfection of BCR-ABL siRNA and GFI1B siRNA dramatically decreased cell viability and significantly induced apoptosis and inhibited proliferation in K562 cells (P<0.0001) and primary advanced phase CML cells (P<0.0001) versus controls. Furthermore, combining of BCR-ABL siRNA and GFI1B siRNA significantly modified the expression of several relevant genes including Myc, MDR1, MRP1 and tyrosyl-phosphoproteins in primary CML c","Apoptosis, Cell Proliferation, Fusion Proteins, bcr-abl/*genetics/metabolism, Gene Expression, Gene Knockdown Techniques, Hematopoietic Stem Cells/metabolism, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive, Proto-Oncogene Proteins/*genetics/metabolism, RNA Inter","Koldehoff M, Zakrzewski JL, Beelen DW, Elmaagacli AH","Cancer Gene Ther. 2013 Jul;20(7):421-7. doi","2013 Jul","cgt201331 [pii], 10.1038/cgt.2013.31 [doi]","Cancer gene therapy"
"203","30049824","BCR-ABL1 mediated miR-150 downregulation through MYC contributed to ","The fusion oncoprotein BCR-ABL1 exhibits aberrant tyrosine kinase activity and it has been proposed that it deregulates signaling networks involving both transcription factors and non-coding microRNAs that result in chronic myeloid leukemia (CML). Previously, microRNA expression profiling showed deregulated expression of miR-150 and miR-155 in CML. In this study, we placed these findings into the broader context of the MYC/miR-150/MYB/miR-155/PU.1 oncogenic network. We propose that up-regulated MYC and miR-155 in CD34(+) leukemic stem and progenitor cells, in concert with BCR-ABL1, impair the molecular mechanisms of myeloid differentiation associated with low miR-150 and PU.1 levels. We revealed that MYC directly occupied the -11.7 kb and -0.35 kb regulatory regions in the MIR150 gene. MYC occupancy was markedly increased through BCR-ABL1 activity, causing inhibition of MIR150 gene expression i","Adult, Aged, Cell Differentiation/drug effects/genetics, Cell Line, Tumor, Cell Proliferation/drug effects/genetics, Down-Regulation/drug effects, Drug Resistance, Neoplasm/drug effects/*genetics, Female, Fusion Proteins, bcr-abl/*genetics, Gene Expression Regulation, Leukemic/drug e","Srutova K, Curik N, Burda P, Savvulidi F, Silvestri G, Trotta R, Klamova H, Pecherkova P, Sovova Z, Koblihova J, Stopka T, Perrotti D, Polakova KM","Haematologica. 2018 Dec;103(12):2016-2025. doi","2018 Dec","haematol.2018.193086 [pii], 10.3324/haematol.2018.193086 [doi]","Haematologica"
"204","24784839","FGFR3 translocations in bladder cancer","UNLABELLED: Activating mutations and/or overexpression of FGFR3 are common in bladder cancer, making FGFR3 an attractive therapeutic target in this disease. In addition, FGFR3 gene rearrangements have recently been described that define a unique subset of bladder tumors. Here, a selective HSP90 inhibitor, ganetespib, induced loss of FGFR3-TACC3 fusion protein expression and depletion of multiple oncogenic signaling proteins in RT112 bladder cells, resulting in potent cytotoxicity comparable with the pan-FGFR tyrosine kinase inhibitor BGJ398. However, in contrast to BGJ398, ganetespib exerted pleiotropic effects on additional mitogenic and survival pathways and could overcome the FGFR inhibitor-resistant phenotype of FGFR3 mutant-expressing 97-7 and MHG-U3 cells. Combinatorial benefit was observed when ganetespib was used with BGJ398 both in vitro and in vivo. Interestingly, two additional FGFR3","Animals, Cell Line, Tumor, Female, HSP90 Heat-Shock Proteins/*antagonists & inhibitors/genetics/metabolism, Humans, Mice, Mice, Nude, Molecular Targeted Therapy, Random Allocation, Receptor, Fibroblast Growth Factor, Type 3/*antagonists & inhibitors/genetics/metabolism, Signal Transd","Acquaviva J, He S, Zhang C, Jimenez JP, Nagai M, Sang J, Sequeira M, Smith DL, Ogawa LS, Inoue T, Tatsuta N, Knowles MA, Bates RC, Proia DA","Mol Cancer Res. 2014 Jul;12(7):1042-54. doi","2014 Jul","1541-7786.MCR-14-0004 [pii], 10.1158/1541-7786.MCR-14-0004 [doi]","Molecular cancer research"
"205","23175443","Oncogenic FGFR3 gene fusions in bladder cancer.","FGF receptor 3 (FGFR3) is activated by mutation or over-expression in many bladder cancers. Here, we identify an additional mechanism of activation via chromosomal re-arrangement to generate constitutively activated fusion genes. FGFR3-transforming acid coiled coil 3 (TACC3) fusions resulting from 4p16.3 re-arrangements and a t(4;7) that generates a FGFR3-BAI1-associated protein 2-like 1 (BAIAP2L1) fusion were identified in 4 of 43 bladder tumour cell lines and 2 of 32 selected tissue samples including the tumour from which one of the cell lines was derived. These are highly activated and transform NIH-3T3 cells. The FGFR3 component is identical in all cases and lacks the final exon that includes the phospholipase C gamma 1 (PLCgamma1) binding site. Expression of the fusions in immortalized normal human urothelial cells (NHUC) induced activation of the mitogen-activated protein kinase pathway b","Amino Acid Sequence, Animals, Base Sequence, Cell Adhesion, Cell Line, Tumor, Cell Transformation, Neoplastic, Chromosome Breakpoints, Chromosomes, Human, Pair 4, Fibroblast Growth Factor 1/physiology, Humans, Mice, Microfilament Proteins/*genetics/metabolism, Microtubule-Associated ","Williams SV, Hurst CD, Knowles MA","Hum Mol Genet. 2013 Feb 15;22(4):795-803. doi","2013 Feb","dds486 [pii], 10.1093/hmg/dds486 [doi]","Human molecular genetics"
"206","25512383","Mechanistic analysis of the role of bromodomain-containing protein 4","NUT midline carcinoma (NMC) is a rare but highly aggressive cancer typically caused by the translocation t(15;19), which results in the formation of the BRD4-NUT fusion oncoprotein. Previous studies have demonstrated that fusion of the NUT protein with the double bromodomains of BRD4 may significantly alter the cellular gene expression profile to contribute to NMC tumorigenesis. However, the mechanistic details of this BRD4-NUT function remain poorly understood. In this study, we examined the NUT function in transcriptional regulation by targeting it to a LacO transgene array integrated in U2OS 2-6-3 cells, which allow us to visualize how NUT alters the in situ gene transcription dynamic. Using this system, we demonstrated that the NUT protein tethered to the LacO locus recruits p300/CREB-binding protein (CBP), induces histone hyperacetylation, and enriches BRD4 to the transgene array chromatin","Cell Cycle Proteins, Cell Line, Tumor, Chromatin Immunoprecipitation, E1A-Associated p300 Protein/genetics/metabolism, Humans, Nuclear Proteins/genetics/*metabolism, Oncogene Proteins, Fusion/genetics/*metabolism, Reverse Transcriptase Polymerase Chain Reaction, Transcription Factors","Wang R, You J","J Biol Chem. 2015 Jan 30;290(5):2744-58. doi","2015 Jan","M114.600759 [pii], 10.1074/jbc.M114.600759 [doi]","The Journal of biological chemistry"
"207","28267803","Correction","[This corrects the article DOI: 10.1371/journal.pone.0156260.].","?","Lin TY, Chen KC, Liu HE, Liu AJ, Wang KL, Shih CM","PLoS One. 2017 Mar 7;12(3):e0173828. doi","2017","10.1371/journal.pone.0173828 [doi], PONE-D-17-08100 [pii]","PloS one"
"208","29262532","Unique signalling connectivity of FGFR3-TACC3 oncoprotein revealed b","The FGFR3-TACC3 fusion is an oncogenic driver in diverse malignancies, including bladder cancer, characterized by upregulated tyrosine kinase activity. To gain insights into distinct properties of FGFR3-TACC3 down-stream signalling, we utilised telomerase-immortalised normal human urothelial cell lines expressing either the fusion or wild-type FGFR3 (isoform IIIb) for subsequent quantitative proteomics and network analysis. Cellular lysates were chemically labelled with isobaric tandem mass tag reagents and, after phosphopeptide enrichment, liquid chromatography-high mass accuracy tandem mass spectrometry (LC-MS/MS) was used for peptide identification and quantification. Comparison of data from the two cell lines under non-stimulated and FGF1 stimulated conditions and of data representing physiological stimulation of FGFR3 identified about 200 regulated phosphosites. The identified phosphoprote","?","Lombardi B, Ashford P, Moya-Garcia AA, Rust A, Crawford M, Williams SV, Knowles MA, Katan M, Orengo C, Godovac-Zimmermann J","Oncotarget. 2017 Oct 25;8(61):102898-102911. doi","2017 Nov","10.18632/oncotarget.22048 [doi], 22048 [pii]","Oncotarget"
"209","22875613","Ponatinib as targeted therapy for FGFR1 fusions associated with the ","The 8p11 myeloproliferative syndrome is a rare, aggressive myeloproliferative neoplasm characterized by constitutively active FGFR1 fusion proteins that arise from specific chromosomal translocations and which drive aberrant proliferation. Although FGFR1 inhibitors have shown in vitro activity against FGFR1 fusions, none are in use clinically and there is a need to assess additional compounds as potential therapy. Here we use cell lines and primary cells to investigate ponatinib (AP24534). Ponatinib-treated Ba/F3 cells transformed by ZMYM2-FGFR1 and BCR-FGFR1 and the FGFR1OP2-FGFR1 positive KG1A cell line showed reduced proliferation and decreased survival when compared to control cells. Inhibition induced apoptosis and reduced phosphorylation of the FGFR1 fusion proteins and substrates. Ponatinib-treated cells from 8p11 myeloproliferative syndrome patients (n=5) showed reduced colony growth co","Aged, Cell Line, Transformed, Dose-Response Relationship, Drug, Female, Humans, Imidazoles/*administration & dosage, Male, Middle Aged, Molecular Targeted Therapy/*methods, Myeloproliferative Disorders/*drug therapy/genetics/pathology, Pyridazines/*administration & dosage, Receptor, ","Chase A, Bryant C, Score J, Cross NC","Haematologica. 2013 Jan;98(1):103-6. doi","2013 Jan","haematol.2012.066407 [pii], 10.3324/haematol.2012.066407 [doi]","Haematologica"
"210","24962792","The TPM3-NTRK1 rearrangement is a recurring event in colorectal carc","The NTRK1 gene encodes Tropomyosin-related kinase A (TRKA), the high-affinity Nerve Growth Factor Receptor. NTRK1 was originally isolated from a colorectal carcinoma (CRC) sample as component of a somatic rearrangement (TPM3-NTRK1) resulting in expression of the oncogenic chimeric protein TPM3-TRKA, but there has been no subsequent report regarding the relevance of this oncogene in CRC. The KM12 human CRC cell line expresses the chimeric TPM3-TRKA protein and is hypersensitive to TRKA kinase inhibition. We report the detailed characterization of the TPM3-NTRK1 genomic rearrangement in KM12 cells and through a cellular screening approach, the identification of NMS-P626, a novel highly potent and selective TRKA inhibitor. NMS-P626 suppressed TPM3-TRKA phosphorylation and downstream signaling in KM12 cells and showed remarkable antitumor activity in mice bearing KM12 tumors. Finally, using quantit","Animals, Blotting, Western, Cell Line, Cell Line, Tumor, Cell Proliferation/drug effects, Humans, Immunoprecipitation, In Vitro Techniques, Mice, Protein Binding/drug effects, Protein Kinase Inhibitors/*pharmacology, Receptor, trkA/*antagonists & inhibitors/*metabolism, Tropomyosin/*","Ardini E, Bosotti R, Borgia AL, De Ponti C, Somaschini A, Cammarota R, Amboldi N, Raddrizzani L, Milani A, Magnaghi P, Ballinari D, Casero D, Gasparri F, Banfi P, Avanzi N, Saccardo MB, Alzani R, Bandiera T, Felder E, Donati D, Pesenti E, Sartore-Bianchi A, Gambacorta M, Pierotti MA, Siena S, Veronese S, G","Mol Oncol. 2014 Dec;8(8):1495-507. doi","2014 Dec","S1574-7891(14)00125-2 [pii], 10.1016/j.molonc.2014.06.001 [doi]","Molecular oncology"
"211","28549458","Detection of ALK fusion transcripts in FFPE lung cancer samples by N","BACKGROUND: ALK-rearranged lung cancers exhibit specific pathologic and clinical features and are responsive to anti-ALK therapies. Therefore, the detection of ALK-rearrangement is fundamental for personalized lung cancer therapy. Recently, new molecular techniques, such as NanoString nCounter, have been developed to detect ALK fusions with more accuracy and sensitivity. METHODS: In the present study, we intended to validate a NanoString nCounter ALK-fusion panel in routine biopsies of FFPE lung cancer patients. A total of 43 samples were analyzed, 13 ALK-positive and 30 ALK-negative, as previously detected by FISH and/or immunohistochemistry. RESULTS: The NanoString panel detected the presence of the EML4-ALK, KIF5B-ALK and TFG-ALK fusion variants. We observed that all the 13 ALK-positive cases exhibited genetic aberrations by the NanoString methodology. Namely, six cases (46.15%) presented EM","Adenocarcinoma/*genetics, Humans, Immunohistochemistry, In Situ Hybridization, Fluorescence, Lung Neoplasms/*genetics, Nanotechnology/methods, Oncogene Proteins, Fusion/*genetics, RNA, Messenger/*analysis, Retrospective Studies, Transcription, Genetic","Evangelista AF, Zanon MF, Carloni AC, de Paula FE, Morini MA, Ferreira-Neto M, Soares IC, Miziara JE, de Marchi P, Scapulatempo-Neto C, Reis RM","BMC Pulm Med. 2017 May 26;17(1):86. doi","2017 May","10.1186/s12890-017-0428-0 [doi], 10.1186/s12890-017-0428-0 [pii]","BMC pulmonary medicine"
"212","26599807","Clinical Validation of a Novel Commercial Reverse Transcription-Quan","CONTEXT: -EGFR mutations and anaplastic lymphoma kinase (ALK) translocations have significant biologic and therapeutic implications in lung cancers, particularly lung adenocarcinomas. ALK translocations are less frequent compared with EGFR mutations; interestingly, these two abnormalities are most commonly mutually exclusive. The 2013 College of American Pathologists/Association for Molecular Pathology/International Association for the Study of Lung Cancer molecular testing guideline for lung cancers recommend a testing algorithm in which detection of ALK translocations using fluorescence in situ hybridization (FISH) is to be performed following testing for EGFR mutations. Such an algorithm is cost-effective but potentially slows down turnaround time; and as a secondary test, ALK FISH assay may not be completed because it requires the use of additional tissue, and the small biopsies or cytology","Anaplastic Lymphoma Kinase, Carcinoma, Non-Small-Cell Lung/*genetics/pathology, Cell Line, Tumor, ErbB Receptors/genetics, *Gene Amplification, Humans, Lung Neoplasms/*genetics/pathology, Receptor Protein-Tyrosine Kinases/*genetics, Reverse Transcriptase Polymerase Chain Reaction/*me","Liu C, Pepper K, Hendrickson H, Cagle PT, Portier BP","Arch Pathol Lab Med. 2016 Jul;140(7):690-3. doi","2016 Jul","10.5858/arpa.2015-0419-OA [doi]","Archives of pathology & laboratory medicine"
"213","30262706","Novel deletion of SLC34A2 in Chinese patients of PAM shares mutation","Pulmonary alveolar microlithiasis (PAM) is an autosomal recessive disorder with distinctive deposition of calcium phosphate microliths in the lungs. Mutation of the SLC34A2 gene was proved to be responsible for PAM. Here, we report the study of a family affected by PAM in China. Two daughters of an inbred family whose parents are cousins and are affected by PAM. Mutation analysis of the SLC34A2 gene by polymerase chain reaction (PCR) amplification and direct sequencing in both patients revealed that exon 5 was deleted on both alleles. Both parents of the patients are proved to be carriers of the mutated allele. Gap-PCR was performed to determine the breakpoints and a homologous deletion of 1152 bp encompassing exon 5 of the SLC34A2 gene (c.IVS4+1452_IVS5+660del) was confirmed. A 4-bp fragment of TGGG was located on the edge of both upstream and downstream breakpoints. The upstream breakpoint li","Asian Continental Ancestry Group, Calcinosis/*genetics/pathology, Female, Genetic Diseases, Inborn/*genetics/pathology, Humans, Lung Diseases/*genetics/pathology, Lung Neoplasms/*genetics/pathology, Male, Mutation, Oncogene Proteins, Fusion/genetics, Pedigree, Protein-Tyrosine Kinase","Dandan S, Yuqin C, Wei L, Ziheng P, Dapeng Z, Jianzhu Y, Xin X, Yonghong L, Fengjun T","J Genet. 2018 Sep;97(4):939-944.","2018 Sep","?","Journal of genetics"
"214","31071955","HDAC1,2 Knock-Out and HDACi Induced Cell Apoptosis in Imatinib-Resis","Since imatinib (Glivec or Gleevec) has been used to target the BCR-ABL fusion protein, chronic myeloid leukemia (CML) has become a manageable chronic disease with long-term survival. However, 15%-20% of CML patients ultimately develop resistance to imatinib and then progress to an accelerated phase and eventually to a blast crisis, limiting treatment options and resulting in a poor survival rate. Thus, we investigated whether histone deacetylase inhibitors (HDACis) could be used as a potential anticancer therapy for imatinib-resistant CML (IR-CML) patients. By applying a noninvasive apoptosis detection sensor (NIADS), we found that panobinostat significantly enhanced cell apoptosis in K562 cells. A further investigation showed that panobinostat induced apoptosis in both K562 and imatinib-resistant K562 (IR-K562) cells mainly via H3 and H4 histone acetylation, whereas panobinostat targeted cance","Acetylation/drug effects, Apoptosis/drug effects, CRISPR-Cas Systems/genetics, Drug Resistance, Neoplasm/drug effects, Fusion Proteins, bcr-abl/antagonists & inhibitors/*genetics, Gene Knockout Techniques, Histone Deacetylase 1/*genetics, Histone Deacetylase 2/*genetics, Histone Deac","Chen SH, Chow JM, Hsieh YY, Lin CY, Hsu KW, Hsieh WS, Chi WM, Shabangu BM, Lee CH","Int J Mol Sci. 2019 May 8;20(9). pii","2019 May","ijms20092271 [pii], 10.3390/ijms20092271 [doi]","International journal of molecular sciences"
"215","31280200","Comparison of BCR-ABL Transcript Variants Between Patients With Chro","BACKGROUND/AIM: Chronic myeloid leukaemia (CML) is a myeloproliferative disorder characterized by the presence of breakpoint cluster region-Abelson murine leukemia (BCR-ABL1) gene fusion as a hallmark that is expressed as two major transcripts b2a2 and b3a2. The aim of this study was to compare the BCR-ABL transcripts in the blood cells of patients with CML, and in chemoresistant and chemosensitive CML cell lines to validate their use as a good method to elucidate CML biology. MATERIALS AND METHODS: Twelve patients with CML and CML cell lines (K562, K562-LUCENA and FEPS) were analyzed by real-time polymerase chain reaction to evaluate gene expression of BCR-ABL transcripts. RESULTS: All patients had the same expression levels of b2a2 and b3a3 transcripts, however, CML cell lines presented only b3a2 expression. There were no significant differences in absolute b3a2 expression between patients an","Adult, Aged, Cell Line, Tumor, Chromosome Breakpoints, Female, Fusion Proteins, bcr-abl/*genetics, *Gene Expression Regulation, Leukemic, *Genetic Variation, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics, Male, Middle Aged, Real-Time Polymerase Chain Reaction, *T","DE Oliveira Sales L, Mesquita FP, DE Sousa Portilho AJ, DE Moraes Filho MO, DE Moraes MEA, Montenegro RC, Moreira-Nunes CA","In Vivo. 2019 Jul-Aug;33(4):1119-1124. doi","2019 Jul","33/4/1119 [pii], 10.21873/invivo.11581 [doi]","In vivo (Athens, Greece)"
"216","28086219","Gadd45a deficiency accelerates BCR-ABL driven chronic myelogenous le","The Gadd45a stress sensor gene is a member in the Gadd45 family of genes that includes Gadd45b & Gadd45g. To investigate the effect of GADD45A in the development of CML, syngeneic wild type lethally irradiated mice were reconstituted with either wild type or Gadd45a null myeloid progenitors transduced with a retroviral vector expressing the 210-kD BCR-ABL fusion oncoprotein. Loss of Gadd45a was observed to accelerate BCR-ABL driven CML resulting in the development of a more aggressive disease, a significantly shortened median mice survival time, and increased BCR-ABL expressing leukemic stem/progenitor cells (GFP+Lin- cKit+Sca+). GADD45A deficient progenitors expressing BCR-ABL exhibited increased proliferation and decreased apoptosis relative to WT counterparts, which was associated with enhanced PI3K-AKT-mTOR-4E-BP1 signaling, upregulation of p30C/EBPalpha expression, and hyper-activation of ","Animals, Apoptosis/genetics, Blast Crisis/genetics/metabolism, Bone Marrow Transplantation/methods, Cell Cycle Proteins/deficiency/*genetics/metabolism, Cell Proliferation/genetics, Cells, Cultured, Flow Cytometry, Fusion Proteins, bcr-abl/*genetics/metabolism, *Gene Expression Regul","Mukherjee K, Sha X, Magimaidas A, Maifrede S, Skorski T, Bhatia R, Hoffman B, Liebermann DA","Oncotarget. 2017 Feb 14;8(7):10809-10821. doi","2017 Feb","14580 [pii], 10.18632/oncotarget.14580 [doi]","Oncotarget"
"217","25692130","Prevalence of gene rearrangements in Mexican children with acute lym","Mexico has one of the highest incidences of childhood leukemia worldwide and significantly higher mortality rates for this disease compared with other countries. One possible cause is the high prevalence of gene rearrangements associated with the etiology or with a poor prognosis of childhood acute lymphoblastic leukemia (ALL). The aims of this multicenter study were to determine the prevalence of the four most common gene rearrangements [ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, and MLL rearrangements] and to explore their relationship with mortality rates during the first year of treatment in ALL children from Mexico City. Patients were recruited from eight public hospitals during 2010-2012. A total of 282 bone marrow samples were obtained at each child's diagnosis for screening by conventional and multiplex reverse transcription polymerase chain reaction to determine the gene rearrangements. Gene rea","Adolescent, Child, Child, Preschool, Disease-Free Survival, *Gene Rearrangement, HL-60 Cells, Humans, Mexico/epidemiology, Oncogene Proteins, Fusion/*genetics, Precursor Cell Lymphoblastic Leukemia-Lymphoma/*diagnosis/*genetics/*mortality/therapy, Prevalence, Survival Rate","Bekker-Mendez VC, Miranda-Peralta E, Nunez-Enriquez JC, Olarte-Carrillo I, Guerra-Castillo FX, Pompa-Mera EN, Ocana-Mondragon A, Rangel-Lopez A, Bernaldez-Rios R, Medina-Sanson A, Jimenez-Hernandez E, Amador-Sanchez R, Penaloza-Gonzalez JG, de Diego Flores-Chapa J, Fajardo-Gutierrez A, Flores-Lujano J, Rod","Biomed Res Int. 2014;2014:210560. doi","2014","10.1155/2014/210560 [doi]","BioMed research international"
"218","23613107","Alantolactone induces apoptosis in chronic myelogenous leukemia sens","Alantolactone, an allergenic sesquiterpene lactone, has recently been found to have significant antitumor effects on malignant tumor cells. Here, we investigated the potential effect of alantolactone on Bcr/Abl+ imatinib-sensitive and -resistant cells. Alantolactone treatment resulted in obvious apoptosis in both imatinib-sensitive and -resistant K562 cells, as shown by the increase in Annexin V-positive cells, caspase-3 activation, poly(ADP-ribose) polymerase-1 (PARP-1) cleavage and mitochondrial membrane potential collapse. Alantolactone significantly inhibited NF-kappaB-dependent reporter gene activity, decreased the DNA-binding activity of NF-capital O, CyrillickappaB, and blocked TNF-alpha-induced IkappaBalpha phosphorylation. Of interest, the oncogenic Bcr/Abl fusion protein but not its mRNA levels were quickly reduced upon alantolactone exposure in imatinib-sensitive and -resistant K562 ","Animals, Apoptosis/*drug effects, Benzamides/*pharmacology, Cell Line, Tumor, Cell Proliferation/drug effects, *Drug Resistance, Neoplasm, Fusion Proteins, bcr-abl/*genetics, *Gene Deletion, Humans, Imatinib Mesylate, Lactones/*pharmacology, Leukemia, Myelogenous, Chronic, BCR-ABL Po","Wei W, Huang H, Zhao S, Liu W, Liu CX, Chen L, Li JM, Wu YL, Yan H","Apoptosis. 2013 Sep;18(9):1060-70. doi","2013 Sep","10.1007/s10495-013-0854-2 [doi]","Apoptosis"
"219","28752075","miR-155 effectively induces apoptosis in K562 Philadelphia positive ","Introduction: Chronic myelogenous leukemia (CML) is a myeloproliferative disorder caused by the Philadelphia chromosome translocation, at (9; 22), which results in BCR-ABL fusion tyrosine kinase oncoprotein. This fusion induces down-regulation of miR-155. Upregulation of miR-155 can influence cell fate via the effect on p27kip1 and apoptosis. The aim of this study was to induce apoptosis in K562 CML cell line by overexpression of miR-155. Methods: The K562 cell line was transfected with pLenti-III-pre mir155-GFP constructs through electroporation. Then, overexpression of miR-155 as well as the expression level of p27kip1 and c-Myc was analyzed by quantitative PCR (qPCR). The level of p27 (Kip1) protein expression was measured by Western blot and the Annexin V method was carried out to investigate apoptosis. Results: Flow cytometric analysis results of K562 cells transfected with pLenti-III-pre ","?","Edalati Fathabad M, Karimipoor M, Alizadeh S, Abdoli A, Atashi A, Sayadi M","Bioimpacts. 2017;7(2):109-114. doi","2017","10.15171/bi.2017.14 [doi]","BioImpacts"
"220","25699654","Gambogic acid induces death of K562 cells through autophagy and apop","This study was aimed to detect the effects of gambogic acid (GA) on the growth of chronic myelogenous leukemia (CML) K562 cells. Our results showed that GA induced the accumulation of autophagic vacuoles and up-regulation of two autophagy-related proteins (Beclin 1 and LC3). GA also induced down-regulation of mRNA levels of BCR-ABL fusion gene and SQSTM1/sequestosome 1 (p62) protein levels. After treatment by chloroquine (CQ) and pan caspase inhibitor Z-VAD-FMK (PC), both GA-induced autophagy and apoptosis were inhibited. Our study demonstrates that GA may induce cell death through autophagy and apoptosis pathways in CML K562 cells. A cross-talk mechanism exists between GA-induced autophagy and apoptosis. However, the mechanism of GA for inducing autophagy and apoptosis need further clarification.","Antineoplastic Agents, Phytogenic/*pharmacology, Apoptosis/*drug effects, Autophagy/*drug effects, Biomarkers, Cell Line, Tumor, Cell Survival/drug effects, Fusion Proteins, bcr-abl/genetics/metabolism, Gene Expression, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Posi","Chen J, Zhou M, Zhang Q, Xu J, Ouyang J","Leuk Lymphoma. 2015;56(10):2953-8. doi","2015","10.3109/10428194.2015.1018251 [doi]","Leukemia & lymphoma"
"221","25740311","Microtubule association of EML proteins and the EML4-ALK variant 3 o","Proteins of the echinoderm microtubule (MT)-associated protein (EMAP)-like (EML) family contribute to formation of the mitotic spindle and interphase MT network. EML1-4 consist of Trp-Asp 40 (WD40) repeats and an N-terminal region containing a putative coiled-coil. Recurrent gene rearrangements in non-small cell lung cancer (NSCLC) fuse EML4 to anaplastic lymphoma kinase (ALK) causing expression of several oncogenic fusion variants. The fusions have constitutive ALK activity due to self-association through the EML4 coiled-coil. We have determined crystal structures of the coiled-coils from EML2 and EML4, which describe the structural basis of both EML self-association and oncogenic EML4-ALK activation. The structures reveal a trimeric oligomerization state directed by a conserved pattern of hydrophobic residues and salt bridges. We show that the trimerization domain (TD) of EML1 is necessary an","Amino Acid Sequence, Carcinoma, Non-Small-Cell Lung/genetics/metabolism, Cell Line, Tumor, Conserved Sequence, Crystallography, X-Ray, HEK293 Cells, HeLa Cells, Humans, Lung Neoplasms/genetics/metabolism, Microtubule-Associated Proteins/*chemistry/genetics/*metabolism, Microtubules/*","Richards MW', ""O'Regan L"", 'Roth D, Montgomery JM, Straube A, Fry AM, Bayliss R","Biochem J. 2015 May 1;467(3):529-36. doi","2015 May","BJ20150039 [pii], 10.1042/BJ20150039 [doi]","The Biochemical journal"
"222","28789344","Role and mechanism of decitabine combined with tyrosine kinase inhib","Patients with advanced chronic myeloid leukemia (CML) have a poor prognosis, with the use of tyrosine kinase inhibitors (TKIs) to treat CML demonstrating poor results. The results of the present study revealed that, following Cell Counting Kit-8 analysis, treatment of K562 cells with decitabine (DAC) combined with TKIs exhibits synergic effects. Co-immunoprecipitation indicated that tyrosine-protein phosphatase non-receptor type 6 (SHP-1) and BCR-ABL fusion protein (BCR-ABL) (p210) form a complex in the K562 cell line, and in the primary cells derived from patients with CML. These results suggested that SHP-1 serves a role in regulating the tyrosine kinase activity of BCR-ABL (p210). In addition, SHP-1 expression increased, while BCR-ABL expression decreased in the group treated with DAC and TKIs combined group compared with the TKI monotherapy group. Treatment with imatinib (IM) demonstrated n","?","Jiang LC, Luo JM","Oncol Lett. 2017 Aug;14(2):1295-1302. doi","2017 Aug","10.3892/ol.2017.6318 [doi], OL-0-0-6318 [pii]","Oncology letters"
"223","27206799","Sensitive and affordable diagnostic assay for the quantitative detec","Accurate detection of altered anaplastic lymphoma kinase (ALK) expression is critical for the selection of lung cancer patients eligible for ALK-targeted therapies. To overcome intrinsic limitations and discrepancies of currently available companion diagnostics for ALK, we developed a simple, affordable and objective PCR-based predictive model for the quantitative measurement of any ALK fusion as well as wild-type ALK upregulation. This method, optimized for low-quantity/-quality RNA from FFPE samples, combines cDNA pre-amplification with ad hoc generated calibration curves. All the models we derived yielded concordant predictions when applied to a cohort of 51 lung tumors, and correctly identified all 17 ALK FISH-positive and 33 of the 34 ALK FISH-negative samples. The one discrepant case was confirmed as positive by IHC, thus raising the accuracy of our test to 100%. Importantly, our method w","Adult, Aged, Aged, 80 and over, Anaplastic Lymphoma Kinase, Carcinoma, Non-Small-Cell Lung/diagnosis/*genetics/pathology, Cell Line, Tumor, Chromosomes, Human, Pair 2/genetics, Cohort Studies, Female, *Gene Rearrangement, Humans, Immunohistochemistry, In Situ Hybridization, Fluoresce","Dama E, Tillhon M, Bertalot G, de Santis F, Troglio F, Pessina S, Passaro A, Pece S, de Marinis F', ""Dell'Orto P"", 'Viale G, Spaggiari L, Di Fiore PP, Bianchi F, Barberis M, Vecchi M","Oncotarget. 2016 Jun 14;7(24):37160-37176. doi","2016 Jun","9471 [pii], 10.18632/oncotarget.9471 [doi]","Oncotarget"
"224","281815","The duty of hospitals and hospital medical staffs to regulate the qu","?","Clinical Competence, Female, Hospitals/*standards, Humans, Joint Commission on Accreditation of Healthcare Organizations, *Jurisprudence, Male, Malpractice/legislation & jurisprudence, Medical Staff, Hospital/*legislation & jurisprudence/standards, Quality of Health Care/*legislation","Goldberg BA","West J Med. 1978 Nov;129(5):443-51.","1978 Nov","?","The Western journal of medicine"
"225","25029499","Identification of drug combinations containing imatinib for treatmen","The BCR-ABL translocation is found in chronic myeloid leukemia (CML) and in Ph+ acute lymphoblastic leukemia (ALL) patients. Although imatinib and its analogues have been used as front-line therapy to target this mutation and control the disease for over a decade, resistance to the therapy is still observed and most patients are not cured but need to continue the therapy indefinitely. It is therefore of great importance to find new therapies, possibly as drug combinations, which can overcome drug resistance. In this study, we identified eleven candidate anti-leukemic drugs that might be combined with imatinib, using three approaches: a kinase inhibitor library screen, a gene expression correlation analysis, and literature analysis. We then used an experimental search algorithm to efficiently explore the large space of possible drug and dose combinations and identified drug combinations that sel","Algorithms, Antineoplastic Agents/administration & dosage/pharmacology/therapeutic use, *Antineoplastic Combined Chemotherapy Protocols, Benzamides/*administration & dosage/*pharmacology/therapeutic use, Cell Line, Tumor, Dose-Response Relationship, Drug, *Drug Discovery, Drug Resist","Kang Y, Hodges A, Ong E, Roberts W, Piermarocchi C, Paternostro G","PLoS One. 2014 Jul 16;9(7):e102221. doi","2014","10.1371/journal.pone.0102221 [doi], PONE-D-14-08111 [pii]","PloS one"
"226","24961450","Electrochemical detection of leukemia oncogenes using enzyme-loaded ","We describe an ultrasensitive electrochemical nucleic acid assay amplified by carbon nanotubes (CNTs)-based labels for the detection of human acute lymphocytic leukemia (ALL)-related p185 BCR-ABL fusion transcript. The carboxylated CNTs were functionalized with horseradish peroxidase (HRP) molecules and target-specific detection probes (DP) via diimide-activated amidation and used to label and amplify the target hybridization signal. The activity of captured HRP was monitored by square-wave voltammetry measuring the electroactive enzymatic product in the presence of 2-aminophenol and hydrogen peroxide substrate solution. The signal-amplified assay achieved a detection limit of 83 fM (5 x 10(-18) mol in 60 muL) targets oligonucleotides and has a 4-order-wide dynamic range of target concentration. The resulting assay allowed robust discrimination between the perfect match and a three-base mismatc","Base Sequence, Biosensing Techniques, Cell Line, Tumor, *Electrochemical Techniques, Enzymes, Immobilized/metabolism, Fusion Proteins, bcr-abl/*genetics, Horseradish Peroxidase/metabolism, Humans, Nanotubes, Carbon/*chemistry, Nucleic Acid Hybridization, Precursor Cell Lymphoblastic ","Lee AC, Du D, Chen B, Heng CK, Lim TM, Lin Y","Analyst. 2014 Sep 7;139(17):4223-30. doi","2014 Sep","10.1039/c3an01156a [doi]","The Analyst"
"227","15994877","Cloned fusion product from a rare t(15;19)(q13.2;p13.1) inhibit S ph","BACKGROUND: Somatically acquired chromosomal translocation is a common mechanism of oncogene activation in many haematopoietic tumours and sarcomas. However, very few recurrent chromosomal translocations have been reported in more common epithelial tumours such as lung carcinomas. METHODS: We established a cell line HCC2429 from an aggressive, metastatic lung cancer arising in a young, non-smoking woman, demonstrating a t(15;19)(q13.2;p13.1). The breakpoints on chromosomes 15 and 19 were cloned using long distance inverse PCR and we determined by RT-PCR that the translocation results in a novel fusion transcript in which the 3' end Brd4 on chromosome 19p is fused to the 5' end of NUT on chromosome 15q. RESULTS: In total, 128 lung cancer tissues were screened using fluorescent in situ hybridisation, but none of the tumours screened demonstrated t(15;19), suggesting that this translocation is not","Adult, Blotting, Northern, Cell Line, Cell Line, Tumor, Cell Nucleus/metabolism, DNA Mutational Analysis, Female, Humans, Lung Neoplasms/*genetics, Nuclear Proteins/biosynthesis/*genetics, Oncogene Proteins, Fusion/biosynthesis/*genetics, Polymerase Chain Reaction, S Phase/*genetics,","Haruki N, Kawaguchi KS, Eichenberger S, Massion PP, Gonzalez A, Gazdar AF, Minna JD, Carbone DP, Dang TP","J Med Genet. 2005 Jul;42(7):558-64. doi","2005 Jul","42/7/558 [pii], 10.1136/jmg.2004.029686 [doi]","Journal of medical genetics"
"228","23201011","Dihydroartemisinin inhibits the Bcr/Abl oncogene at the mRNA level i","Due to the mutations of the Bcr/Abl oncogene that obstacle the binding of the protein with imatinib, the resistance to imatinib has developed in a significant portion of chronic myeloid leukemia (CML) patients. It stimulated the search for novel molecules for treatment of imatinib-resistance CML. Inhibiting the amplification of Bcr/Abl oncogene is believed to be a new effective strategy to override the imatinib resistance on CML cells. In present research, we demonstrated that dihydroartemisinin (DHA), a safe and effective antimalarial analog of artemisinin, could significantly inhibit the Bcr/Abl fusion gene at the mRNA level in CML cells sensitive or resistant to imatinib (including the primary CML cells with T315I mutation) and induce cell death. Moreover, dihydroartemisinin could also lead to the inhibition of the Bcr/Abl protein expression and tyrosine kinase activity, and strongly suppres","Antimalarials/pharmacology, Apoptosis/drug effects/genetics, Artemisinins/*pharmacology, Benzamides/*pharmacology, Caspase 3/genetics/metabolism, Caspase 9/genetics/metabolism, Cell Line, Tumor, Cytochromes c/genetics/metabolism, Drug Resistance, Neoplasm/*drug effects, Fusion Protei","Lee J, Shen P, Zhang G, Wu X, Zhang X","Biomed Pharmacother. 2013 Mar;67(2):157-63. doi","2013 Mar","S0753-3322(12)00109-6 [pii], 10.1016/j.biopha.2012.10.017 [doi]","Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie"
"229","29046997","Membrane perturbation through novel cell-penetrating peptides influe","Chronic myeloid leukemia is a stem cell disease with the presence of Philadelphia chromosome generated through reciprocal translocation of chromosome 9 and 22. The use of first- and second-generation tyrosine kinase inhibitors has been successful to an extent. However, resistance against such drugs is an emerging problem. Apart from several drug-resistant mechanisms, drug influx/efflux ratio appears to be one of the key determinants of therapeutic outcomes. In addition, intracellular accumulation of drug critically depends on cell membrane fluidity and lipid raft dynamics. Previously, we reported two novel cell-penetrating peptides (CPPs), namely, cationic IR15 and anionic SR11 present in tryptic digest of Abrus agglutinin. Here, the potential of IR15 and SR11 to influence intracellular concentration of imatinib has been evaluated. Fluorescent correlation spectroscopy and lifetime imaging were ","Cell Membrane/drug effects/*metabolism, Cell Proliferation/drug effects, Cell Survival/drug effects, Cell-Penetrating Peptides/administration & dosage/*pharmacology, Diffusion, Humans, Imatinib Mesylate/administration & dosage/*metabolism, Intracellular Space/*metabolism, K562 Cells,","Mukherjee D, Kundu N, Chakravarty L, Behera B, Chakrabarti P, Sarkar N, Maiti TK","Cell Biol Toxicol. 2018 Jun;34(3):233-245. doi","2018 Jun","10.1007/s10565-017-9414-9 [doi], 10.1007/s10565-017-9414-9 [pii]","Cell biology and toxicology"
"230","22875628","Ruxolitinib as potential targeted therapy for patients with JAK2 rea","JAK2 fusion genes are rare but recurrent abnormalities associated with diverse, clinically heterogeneous hematologic malignancies. Here we assess the JAK1/2 inhibitor ruxolitinib as therapy for patients with JAK2-rearrangement associated myeloproliferative neoplasms (MPN). Ruxolitinib-treated Ba/F3 cells transformed to IL3 independence by ETV6-JAK2 showed reduced proliferation and survival (IC(50) = 370 nM) compared with KG1A or Ba/F3 cells transformed by BCR-ABL1, SPBN1-FLT3 and ZMYM2-FGFR1 (IC(50) > 10 muM for all). Inhibition was associated with reduced phosphorylation of ETV6-JAK2, ERK, STAT5 and AKT. Primary cell growth from 2 patients with JAK2 rearrangement and one patient with JAK2 amplification was assessed in methylcellulose assays. Reduced colony growth was seen for all patients in ruxolitinib-treated cultures compared with healthy controls (n=7). Fluorescence in situ hybridization s","Aged, Cell Line, Tumor, Gene Amplification, Humans, Janus Kinase 2/*antagonists & inhibitors/*genetics, Male, Middle Aged, Molecular Targeted Therapy, Myeloproliferative Disorders/diagnosis/drug therapy/genetics, Oncogene Proteins, Fusion/genetics/metabolism, Protein Kinase Inhibitor","Chase A, Bryant C, Score J, Haferlach C, Grossmann V, Schwaab J, Hofmann WK, Reiter A, Cross NC","Haematologica. 2013 Mar;98(3):404-8. doi","2013 Mar","haematol.2012.067959 [pii], 10.3324/haematol.2012.067959 [doi]","Haematologica"
"231","27353341","Drug repurposing for chronic myeloid leukemia","Chronic myeloid leukemia (CML) is caused by chromosomal rearrangement resulting in the expression of Bcr-Abl fusion protein with deregulated Abl tyrosine kinase activity. Approved drugs - imatinib, dasatinib, nilotinib, and ponatinib - target the ATP-binding site of Abl kinase. Even though these drugs are initially effective, long-term usefulness is limited by the development of resistance. To overcome this problem, targeting the allosteric site of Abl kinase, which is remote from the ATP-binding site is found to be a useful strategy. In this study, structure-based and ligand-based virtual screening methods were applied to narrow down possible drugs (from DrugBank database) that could target the allosteric site of Abl kinase. Detailed investigations of the selected drugs in the allosteric site of Abl kinase, using molecular dynamics and steered molecular dynamics simulation shows that gefitinib","Allosteric Site, Antineoplastic Agents/*pharmacology, Binding Sites, Catalytic Domain, Cell Proliferation/drug effects, Dasatinib/pharmacology, Databases, Chemical, Drug Combinations, *Drug Repositioning, Drug Resistance, Neoplasm, Drug Synergism, ErbB Receptors/antagonists & inhibit","Singh VK, Chang HH, Kuo CC, Shiao HY, Hsieh HP, Coumar MS","J Biomol Struct Dyn. 2017 Jun;35(8):1833-1848. doi","2017 Jun","10.1080/07391102.2016.1196462 [doi]","Journal of biomolecular structure & dynamics"
"232","31138265","Efficient disruption of bcr-abl gene by CRISPR RNA-guided FokI nucle","BACKGROUND: The bcr-abl fusion gene encodes BCR-ABL oncoprotein and plays a crucial role in the leukemogenesis of chronic myeloid leukemia (CML). Current therapeutic methods have limited treatment effect on CML patients with drug resistance or disease relapse. Therefore, novel therapeutic strategy for CML is essential to be explored and the CRISPR RNA-guided FokI nucleases (RFNs) meet the merits of variable target sites and specificity of cleavage enabled its suitability for gene editing of CML. The RFNs provide us a new therapeutic direction to obliterate this disease. METHODS: Guide RNA (gRNA) expression plasmids were constructed by molecular cloning technique. The modification rate of RFNs on bcr-abl was detected via NotI restriction enzyme digestion and T7 endonuclease 1 (T7E1) assay. The expression of BCR-ABL and its downstream signaling molecules were determined by western blotting. The e","Animals, Apoptosis, CRISPR-Cas Systems, Cell Line, Tumor, Cell Proliferation, Deoxyribonucleases/*metabolism, Fusion Proteins, bcr-abl/*antagonists & inhibitors, Gene Editing/*methods, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics/*therapy, Mice, Signa","Luo Z, Gao M, Huang N, Wang X, Yang Z, Yang H, Huang Z, Feng W","J Exp Clin Cancer Res. 2019 May 28;38(1):224. doi","2019 May","10.1186/s13046-019-1229-5 [doi], 10.1186/s13046-019-1229-5 [pii]","Journal of experimental & clinical cancer research"
"233","24909170","Ligand-associated ERBB2/3 activation confers acquired resistance to ","Somatic alterations of fibroblast growth factor receptors (FGFRs) have been described in a wide range of malignancies. A number of anti-FGFR therapies are currently under investigation in clinical trials for subjects with FGFR gene amplifications, mutations and translocations. Here, we develop cell line models of acquired resistance to FGFR inhibition by exposure of cell lines harboring FGFR3 gene amplification and translocation to the selective FGFR inhibitor BGJ398 and multitargeted FGFR inhibitor ponatinib. We show that the acquisition of resistance is rapid, reversible and characterized by an epithelial to mesenchymal transition and a switch from dependency on FGFR3 to ERBB family members. Acquired resistance was associated with demonstrable changes in gene expression including increased production of ERBB2/3 ligands, which were sufficient to drive resistance in the setting of FGFR3 depende","Cell Line, Tumor, Drug Resistance, Neoplasm/*drug effects/genetics, Enzyme Activation/drug effects/genetics, *Epithelial-Mesenchymal Transition, Humans, Imidazoles/*pharmacology, Phenylurea Compounds/*pharmacology, Protein Kinase Inhibitors/*pharmacology, Pyridazines/*pharmacology, P","Wang J, Mikse O, Liao RG, Li Y, Tan L, Janne PA, Gray NS, Wong KK, Hammerman PS","Oncogene. 2015 Apr 23;34(17):2167-77. doi","2015 Apr","onc2014161 [pii], 10.1038/onc.2014.161 [doi]","Oncogene"
"234","27890928","Identification and characterization of activating ABL1 1b kinase mut","Although pathologically activated ABL1 fusion kinases represent well-validated therapeutic targets, tumor genomic sequencing has identified numerous point mutations in the ABL1 proto-oncogene of unclear significance. Here we describe ten novel ABL1 1b point mutations, including two from clinical isolates, that cause constitutive kinase activation and cellular transformation. All mutants retained sensitivity to ATP-competitive tyrosine kinase inhibitors (TKIs). Several substitutions cluster near the myristoyl-binding pocket, the target of ABL001, a novel clinically active allosteric kinase inhibitor that mimics the autoinhibitory myristoyl group, and likely activate the kinase by relieving physiologic autoinhibition. In addition, several mutations activate the kinase and confer resistance to allosteric inhibition despite a lack of proximity to this region. We demonstrate that BCR-ABL1 and ABL1 1","Adenosine Triphosphate, Allosteric Regulation, Binding Sites, Cell Line, Enzyme Activation, Fusion Proteins, bcr-abl, Humans, Myristic Acid/metabolism, Point Mutation/*genetics, Protein Kinase Inhibitors/pharmacology, Proto-Oncogene Proteins c-abl/*genetics, Sequence Analysis, DNA","Lee BJ, Shah NP","Leukemia. 2017 May;31(5):1096-1107. doi","2017 May","leu2016353 [pii], 10.1038/leu.2016.353 [doi]","Leukemia"
"235","27029060","Trichlorobenzene-substituted azaaryl compounds as novel FGFR inhibit","In the present study, we examined the antitumor activity of a series of trichlorobenzene-substituted azaaryl compounds and identified MPT0L145 as a novel FGFR inhibitor with better selectivity for FGFR1, 2 and 3. It was preferentially effective in FGFR-activated cancer cells, including bladder cancer cell lines expressing FGFR3-TACC3 fusion proteins (RT-112, RT-4). MPT0L145 decreased the phosphorylation of FGFR1, FGFR3 and their downstream proteins (FRS2, ERK and Akt). Mechanistically, cDNA microarray analysis revealed that MPT0L145 decreased genes associated cell cycle progression, and increased genes associated with autophagy pathway. Accordingly, the data revealed that MPT0L145 induced G0/G1 cell cycle arrest and decreased protein levels of cyclin E. Moreover, we provided the evidence that autophagy contributes to FGFR inhibitor-related cell death. Finally, MPT0L145 exhibited comparable anti","Animals, Antineoplastic Agents/chemical synthesis/*pharmacology, Cell Cycle Checkpoints/drug effects, Cell Line, Tumor, Cell Proliferation/drug effects, Drug Screening Assays, Antitumor, Humans, Mice, Mice, Nude, Phenylurea Compounds/chemical synthesis/*pharmacology, Receptor, Fibrob","Chen CH, Liu YM, Pan SL, Liu YR, Liou JP, Yen Y","Oncotarget. 2016 May 3;7(18):26374-87. doi","2016 May","8380 [pii], 10.18632/oncotarget.8380 [doi]","Oncotarget"
"236","22915320","ROS1 receptor tyrosine kinase, a druggable target, is frequently ove","BACKGROUND: Microarray analyses have revealed significantly elevated expression of the proto-oncogene ROS1 receptor tyrosine kinase in 20-30% of non-small cell lung carcinomas (NSCLC). Selective and potent ROS1 kinase inhibitors have recently been developed and oncogenic rearrangement of ROS1 in NSCLC identified. METHODS: We performed immunohistochemical evaluation of expression of ROS1 kinase and its downstream molecules in 399 NSCLC cases. ROS1 expression in primary and recurring lesions of 92 recurrent NSCLC cases was additionally analyzed. To elucidate mechanism of expression, two ROS1-nonexpressing NSCLC cell lines (Calu6 and H358) and fresh frozen tissues from 28 consecutive NSCLC patients were examined for ROS1 promoter methylation status and ROS1 expression. RESULTS: Overall expression rate of ROS1 was 22% (19% for adenocarcinomas and 25% for nonadenocarcinomas) in NSCLC. ROS1 expressio","Adenocarcinoma/*metabolism/pathology, Carcinoma, Non-Small-Cell Lung/*metabolism/pathology, Cell Line, Tumor, Chi-Square Distribution, DNA Methylation, Epigenesis, Genetic, Female, Gene Expression Regulation, Neoplastic, Humans, Immunohistochemistry, Kaplan-Meier Estimate, Lung Neopl","Lee HJ, Seol HS, Kim JY, Chun SM, Suh YA, Park YS, Kim SW, Choi CM, Park SI, Kim DK, Kim YH, Jang SJ","Ann Surg Oncol. 2013 Jan;20(1):200-8. doi","2013 Jan","10.1245/s10434-012-2553-6 [doi]","Annals of surgical oncology"
"237","28751539","Mechanisms of Resistance to NTRK Inhibitors and Therapeutic Strategi","Neurotrophic receptor tyrosine kinase 1 (NTRK1) gene rearrangement leads to constitutive activation of NTRK1, which induces high-transforming ability. NTRK-rearranged cancers have been identified in several cancer types, such as glioblastoma, non-small cell lung cancer, and colorectal cancer. Although there are currently no clinically approved inhibitors that target NTRK1, several tyrosine kinase inhibitors (TKI), such as entrectinib and LOXO-101, are in clinical trials. The purpose of this study was to identify potential mechanisms of resistance to NTRK inhibitors and find potential therapeutic strategies to overcome the resistance. We examined the sensitivity of TPM3-NTRK1-transformed Ba/F3 cells and TPM3-NTRK1-harboring KM12 cells to multiple NTRK inhibitors. Acquired NTRK inhibitor-resistant mutations were screened by N-ethyl-N-nitrosourea mutagenesis with Ba/F3-TPM3-NTRK1 cells or by the e","Anilides/administration & dosage, Benzamides/administration & dosage, Cell Line, Tumor, Drug Resistance, Neoplasm/drug effects/*genetics, Gene Rearrangement/genetics, Humans, Indazoles/administration & dosage, Mutation, Neoplasms/*drug therapy/genetics/pathology, Protein Kinase Inhib","Fuse MJ, Okada K, Oh-Hara T, Ogura H, Fujita N, Katayama R","Mol Cancer Ther. 2017 Oct;16(10):2130-2143. doi","2017 Oct","1535-7163.MCT-16-0909 [pii], 10.1158/1535-7163.MCT-16-0909 [doi]","Molecular cancer therapeutics"
"238","25485910","Mutations in G protein beta subunits promote transformation and kina","Activating mutations in genes encoding G protein alpha (Galpha) subunits occur in 4-5% of all human cancers, but oncogenic alterations in Gbeta subunits have not been defined. Here we demonstrate that recurrent mutations in the Gbeta proteins GNB1 and GNB2 confer cytokine-independent growth and activate canonical G protein signaling. Multiple mutations in GNB1 affect the protein interface that binds Galpha subunits as well as downstream effectors and disrupt Galpha interactions with the Gbetagamma dimer. Different mutations in Gbeta proteins clustered partly on the basis of lineage; for example, all 11 GNB1 K57 mutations were in myeloid neoplasms, and seven of eight GNB1 I80 mutations were in B cell neoplasms. Expression of patient-derived GNB1 variants in Cdkn2a-deficient mouse bone marrow followed by transplantation resulted in either myeloid or B cell malignancies. In vivo treatment with the","Animals, Cell Line, Tumor, Cell Transformation, Neoplastic/*genetics, Drug Resistance, Neoplasm/*genetics, Fusion Proteins, bcr-abl/antagonists & inhibitors/genetics, GTP-Binding Protein beta Subunits/*genetics/metabolism, GTP-Binding Proteins/*genetics/metabolism, Gene Expression Re","Yoda A, Adelmant G, Tamburini J, Chapuy B, Shindoh N, Yoda Y, Weigert O, Kopp N, Wu SC, Kim SS, Liu H, Tivey T, Christie AL, Elpek KG, Card J, Gritsman K, Gotlib J, Deininger MW, Makishima H, Turley SJ, Javidi-Sharifi N, Maciejewski JP, Jaiswal S, Ebert BL, Rodig SJ, Tyner JW, Marto JA, Weinstock DM, Lane ","Nat Med. 2015 Jan;21(1):71-5. doi","2015 Jan","nm.3751 [pii], 10.1038/nm.3751 [doi]","Nature medicine"
"239","28323047","Biochemical and chemical characterization of Cynara cardunculus L. e","ETHNOPHARMACOLOGICAL RELEVANCE: Ancient mediterranean diet was characterized by consuming the spontaneous forms of Cynara cardunculus L. (CCL), commonly called artichoke. Cultivated and/or spontaneous forms of CC studies have demonstrated that methanol extract of CCL flower and/or cynaropicrin showed remarkable anti-proliferative activity in vitro models of leukocyte cancer cell. AIM OF THE STUDY: Chronic myeloid leukemia (CML) is associated with a reciprocal translocation of the long arms of chromosomes 9 and 22 generating the BCR/ABL fusion gene, translated in the p210(BCR/ABL) oncoprotein kinase. This chimeric protein is the target of a kinase inhibitor, imatinib, but the development of mutations in the ABL kinase domain resulting in drug resistance and several approaches to overcoming resistance have been study. In this concern, we investigated the effect of CCL extract on human K562 CML an","Antineoplastic Agents/pharmacology, Antineoplastic Agents, Phytogenic/*therapeutic use, Cell Survival/drug effects, Chemotherapy, Adjuvant, Cynara/*chemistry, Drug Resistance, Neoplasm/drug effects, Fusion Proteins, bcr-abl/antagonists & inhibitors, Humans, Imatinib Mesylate/pharmaco","Russo A, Perri M, Cione E, Di Gioia ML, Nardi M, Cristina Caroleo M","J Ethnopharmacol. 2017 Apr 18;202:184-191. doi","2017 Apr","S0378-8741(17)30269-6 [pii], 10.1016/j.jep.2017.03.026 [doi]","Journal of ethnopharmacology"
"240","28032602","Detection of ALK rearrangements in lung cancer patients using a home","Lung cancer patients with anaplastic lymphoma kinase (ALK) rearrangements are candidates for targeted therapeutics. However, patients must be tested with a companion diagnostic assay to realize their ALK rearrangement status. We analyzed the publicly available E-GEOD-31210 microarray dataset and identified a non-coding RNA, sweyjawbu, which is strongly associated with ALK rearrangements. We validated these results using quantitative real-time PCR in an independent cohort consisting of 4 cell lines and 83 clinical samples. We could differentiate between ALK rearrangement-positive and -negative lung cancer samples by comparing sweyjawbu expression. Additionally, ALK rearrangement status was determined by comparing the expression of the 5' and 3' regions of the ALK transcript or by detecting known ALK hybrid subtypes. Thus, using our homebrew PCR assay, we were able to accurately detect ALK rearra","Anaplastic Lymphoma Kinase, Biomarkers, Tumor/*genetics, Cell Line, Tumor, Databases, Genetic, Early Detection of Cancer/*methods, Gene Expression Profiling/methods, *Gene Rearrangement, Genetic Predisposition to Disease, Humans, Lung Neoplasms/enzymology/*genetics/pathology/therapy,","Yu H, Chang J, Liu F, Wang Q, Lu Y, Zhang Z, Shen J, Zhai Q, Meng X, Wang J, Ye X","Oncotarget. 2017 Jan 31;8(5):7722-7728. doi","2017 Jan","13886 [pii], 10.18632/oncotarget.13886 [doi]","Oncotarget"
"241","29463555","Foretinib Overcomes Entrectinib Resistance Associated with the NTRK1","Purpose: Rearrangement of the neurotrophic tropomyosin receptor kinase 1 (NTRK1) gene, which encodes tyrosine receptor kinase A (TRK-A), occurs in various cancers, including colon cancer. Although entrectinib is effective in the treatment of central nervous system (CNS) metastases that express NTRK1 fusion proteins, acquired resistance inevitably results in recurrence. The CNS is a sanctuary for targeted drugs; however, the mechanism by which CNS metastases become entrectinib-resistant remains elusive and must be clarified to develop better therapeutics.Experimental Design: The entrectinib-resistant cell line KM12SM-ER was developed by continuous treatment with entrectinib in the brain metastasis-mimicking model inoculated with the entrectinib-sensitive human colon cancer cell line KM12SM, which harbors the TPM3-NTRK1 gene fusion. The mechanism of entrectinib resistance in KM12SM-ER cells was e","Amino Acid Substitution, Anilides/chemistry/*pharmacology, Animals, Benzamides/chemistry/*pharmacology, Brain Neoplasms/*genetics/pathology, Cell Line, Tumor, Cell Survival/drug effects/genetics, Disease Models, Animal, Dose-Response Relationship, Drug, Drug Resistance, Neoplasm/*dru","Nishiyama A, Yamada T, Kita K, Wang R, Arai S, Fukuda K, Tanimoto A, Takeuchi S, Tange S, Tajima A, Furuya N, Kinoshita T, Yano S","Clin Cancer Res. 2018 May 15;24(10):2357-2369. doi","2018 May","1078-0432.CCR-17-1623 [pii], 10.1158/1078-0432.CCR-17-1623 [doi]","Clinical cancer research"
"242","24885608","Extraordinary response to crizotinib in a woman with squamous cell l","BACKGROUND: The discovery of the fusion gene echinodermmicro tubule associated proteinlike 4-anaplastic lymphoma kinase, EML4-ALK, in patients with non-small-cell lung cancer has led to the remarkable development of anaplastic lymphoma kinase inhibitors, such as crizotinib. Consequently, the clinical outcomes of these patients have improved dramatically. Herein, we report the case of a woman with ALK gene translocation-squamous cell lung cancer who experienced a remarkable tumor response to crizotinib after two courses of failed chemotherapy. CASE PRESENTATION: A 55-year-old Chinese woman was diagnosed with cervical lymph node metastatic squamous carcinoma. Chest computed tomography scan showed the primary tumor in the lower lobe of the right lung. The patient had received two successive courses of first-line chemotherapy without tumor response. Tumor cells were negative for wild-type of epider","Administration, Oral, Antineoplastic Combined Chemotherapy Protocols/administration & dosage, Biopsy, Needle, Carcinoma, Squamous Cell/diagnostic imaging/*drug therapy/*pathology, China, Crizotinib, Dose-Response Relationship, Drug, Drug Administration Schedule, Female, Follow-Up Stu","Wang Q, He Y, Yang X, Wang Y, Xiao H","BMC Pulm Med. 2014 May 15;14:83. doi","2014 May","1471-2466-14-83 [pii], 10.1186/1471-2466-14-83 [doi]","BMC pulmonary medicine"
"243","29636358","Resistance Mechanisms to Targeted Therapies in ROS1(+) and ALK(+) No","Purpose: Despite initial benefit from tyrosine kinase inhibitors (TKIs), patients with advanced non-small cell lung cancer (NSCLC) harboring ALK (ALK(+)) and ROS1 (ROS1(+)) gene fusions ultimately progress. Here, we report on the potential resistance mechanisms in a series of patients with ALK(+) and ROS1(+) NSCLC progressing on different types and/or lines of ROS1/ALK-targeted therapy.Experimental Design: We used a combination of next-generation sequencing (NGS), multiplex mutation assay, direct DNA sequencing, RT-PCR, and FISH to identify fusion variants/partners and copy-number gain (CNG), kinase domain mutations (KDM), and copy-number variations (CNVs) in other cancer-related genes. We performed testing on 12 ROS1(+) and 43 ALK(+) patients.Results: One of 12 ROS1(+) (8%) and 15 of 43 (35%) ALK (+) patients harbored KDM. In the ROS1(+) cohort, we identified KIT and beta-catenin mutations and","Adult, Aged, Anaplastic Lymphoma Kinase/chemistry/*genetics, Biomarkers, Tumor, Carcinoma, Non-Small-Cell Lung/diagnosis/drug therapy/*genetics, Computational Biology/methods, DNA Copy Number Variations, Drug Resistance, Neoplasm/*genetics, Female, High-Throughput Nucleotide Sequenci","McCoach CE, Le AT, Gowan K, Jones K, Schubert L, Doak A, Estrada-Bernal A, Davies KD, Merrick DT, Bunn PA Jr, Purcell WT, Dziadziuszko R, Varella-Garcia M, Aisner DL, Camidge DR, Doebele RC","Clin Cancer Res. 2018 Jul 15;24(14):3334-3347. doi","2018 Jul","1078-0432.CCR-17-2452 [pii], 10.1158/1078-0432.CCR-17-2452 [doi]","Clinical cancer research"
"244","29113191","How to detect the rare BCR-ABL (e14a3) transcript","The Philadelphia (Ph; BCR-ABL) chromosome originates from a translocation event between chromosomes 9 and 22, and results in the BCR-ABL fusion gene. In chronic myelogenous leukemia (CML), the BCR-ABL gene is mainly coded for by a major breakpoint cluster region (M-bcr, e13a2 and e14a2). However, in some patients, BCR-ABL genes are encoded by a minor (m)-bcr, e1a2, and a micro (micro)-bcr region, e19a2. These transcripts revealed a different clinical course. The present study described a CML patient whose cytogenetics and FISH analyses of bone marrow revealed a karyotype of 46, XY t(9,22) (q34;q11), while the commercial kits of quantitative PCR (qPCR) failed to detect the BCR-ABL fusion gene. Further multiplex Reverse transcription-PCR (RT-PCR) and sequencing analyses identified a rare e14a3 (b3a3) fusion transcript.","?","Hu LH, Pu LF, Yang DD, Zhang C, Wang HP, Ding YY, Li MM, Zhai ZM, Xiong S","Oncol Lett. 2017 Nov;14(5):5619-5623. doi","2017 Nov","10.3892/ol.2017.6847 [doi], OL-0-0-6847 [pii]","Oncology letters"
"245","26456889","Inhibition of crosstalk between Bcr-Abl and PKC signaling by PEITC, ","Chronic myelogenous leukemia (CML), a clonal hyperproliferation of immature blood cells accounts for 20% of adult leukemia cases. Reciprocal translocation of chromosomes 9 and 22, results into Bcr-Abl fusion and is responsible for expression of a tyrosine kinase protein p210(bcr/abl), which mediates several survival pathways and confer therapeutic resistance. Protein kinase C (PKC), a family of serine threonine kinases play an important role in the process of leukemogenesis. A crosstalk between Bcr-Abl and PKC signaling has been documented. Therefore, targeting p210(bcr/abl) and its associated signaling proteins using non-toxic natural means will be an effective strategy for antileukemic therapy. Aim of the present study is to investigate whether PEITC, a natural isothiocyanate in combination with imatinib mesylate (IM), a tyrosine kinase inhibitor could increase the therapeutic efficacy of IM ","Anticarcinogenic Agents/pharmacology, Antineoplastic Combined Chemotherapy Protocols/pharmacology, Cell Line, Tumor/drug effects, Extracellular Signal-Regulated MAP Kinases/metabolism, Fusion Proteins, bcr-abl/antagonists & inhibitors/genetics/*metabolism, Humans, Imatinib Mesylate/a","Roy M, Sarkar R, Mukherjee A, Mukherjee S","Chem Biol Interact. 2015 Dec 5;242:195-201. doi","2015 Dec","S0009-2797(15)30083-1 [pii], 10.1016/j.cbi.2015.10.004 [doi]","Chemico-biological interactions"
"246","25216532","Mapping of apoptin-interaction with BCR-ABL1, and development of apo","Majority of chronic myeloid leukemia patients experience an adequate therapeutic effect from imatinib however, 26-37% of patients discontinue imatinib therapy due to a suboptimal response or intolerance. Here we investigated derivatives of apoptin, a chicken anemia viral protein with selective toxicity towards cancer cells, which can be directed towards inhibiting multiple hyperactive kinases including BCR-ABL1. Our earlier studies revealed that a proline-rich segment of apoptin interacts with the SH3 domain of fusion protein BCR-ABL1 (p210) and acts as a negative regulator of BCR-ABL1 kinase and its downstream targets. In this study we show for the first time, the therapeutic potential of apoptin-derived decapeptide for the treatment of CML by establishing the minimal region of apoptin interaction domain with BCR-ABL1. We further show that the apoptin decapeptide is able to inhibit BCR-ABL1 do","Animals, Capsid Proteins/*pharmacology, Cell Proliferation/drug effects, Drug Resistance, Neoplasm, Fusion Proteins, bcr-abl/antagonists & inhibitors/*metabolism, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/blood/*drug therapy/pathology, Mice, Molecular Targe","Jangamreddy JR, Panigrahi S, Lotfi K, Yadav M, Maddika S, Tripathi AK, Sanyal S, Los MJ","Oncotarget. 2014 Aug 30;5(16):7198-211. doi","2014 Aug","2278 [pii], 10.18632/oncotarget.2278 [doi]","Oncotarget"
"247","30791979","miR-100-5p confers resistance to ALK tyrosine kinase inhibitors Criz","Lung cancer causes the highest number of cancer-related deaths worldwide. Resistance to therapy is a major clinical issue contributing to the poor prognosis of lung cancer. In recent years, targeted therapy has become a concept where subgroups of non-small cell lung cancer (NSCLC) with genetically altered receptor tyrosine kinases are targeted by tyrosine kinase inhibitors (TKIs). One such subgroup harbors a gene fusion of echinoderm microtubule-associated protein-like 4 (EML4) with anaplastic lymphoma kinase (ALK). Although most NSCLC patients with EML4-ALK fusions initially respond to ALK TKI-therapy they eventually develop resistance. While ALK kinase domain mutations contribute to ALK TKI-refractoriness, they are only present in a fraction of all ALK TKI-resistant tumors. In this study we sought to explore a possible involvement of microRNAs (miRNAs) in conferring resistance to ALK TKIs in ","Anaplastic Lymphoma Kinase/antagonists & inhibitors/*genetics, Antineoplastic Agents/pharmacology, Carcinoma, Non-Small-Cell Lung/*drug therapy/genetics, Cell Cycle Proteins/*genetics, Cell Line, Tumor, Crizotinib/pharmacology, Drug Resistance, Neoplasm, Gene Expression Regulation, N","Lai Y, Kacal M, Kanony M, Stukan I, Jatta K, Kis L, Norberg E, Vakifahmetoglu-Norberg H, Lewensohn R, Hydbring P, Ekman S","Biochem Biophys Res Commun. 2019 Apr 2;511(2):260-265. doi","2019 Apr","S0006-291X(19)30197-4 [pii], 10.1016/j.bbrc.2019.02.016 [doi]","Biochemical and biophysical research communications"
"248","25202073","The multi-tyrosine kinase inhibitor TKI258, alone or in combination ","BACKGROUND/AIM: BCR-ABL-positive (BCR-ABL(+)) leukemia is very difficult to treat although much improvement has been achieved due to the clinical application of imatinib and the second-generation tyrosine kinase inhibitors (TKIs). This study aimed to evaluate for the first time the treatment value of the multiple tyrosine kinase inhibitor TKI258 in BCR-ABL(+) leukemia. MATERIALS AND METHODS: Proliferation of different BCR-ABL(+) leukemic cells was measured with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay; cell apoptosis with Annexin V/propidium iodide (PI) and flow cytometry. Gene expression at the protein level was determined by western blotting. RESULTS: This drug showed treatment efficacy in naive and imatinib-resistant BCR-ABL(+) leukemia cells, particularly in cells harboring T315I-mutated BCR-ABL, for which no effective inhibitor is available to date. By combi","Antineoplastic Agents/*pharmacology, Apoptosis/drug effects, Benzimidazoles/*pharmacology, Cell Line, Tumor, Cell Proliferation/drug effects, Drug Synergism, Everolimus, Fusion Proteins, bcr-abl/*genetics, Humans, Leukemia/drug therapy/*genetics, Protein Kinase Inhibitors/*pharmacolo","Eucker J, Zang C, Zhou Y, Li X, Habbel P, Neumann C, Scholz C, Liu H","Anticancer Res. 2014 Sep;34(9):4909-14.","2014 Sep","34/9/4909 [pii]","Anticancer research"
"249","24792336","TaqMan based real time PCR assay targeting EML4-ALK fusion transcrip","OBJECTIVES: Lung cancer with the ALK rearrangement constitutes only a small fraction of patients with non-small cell lung cancer (NSCLC). However, in the era of molecular-targeted therapy, efficient patient selection is crucial for successful treatment. In this context, an effective method for EML4-ALK detection is necessary. We developed a new highly sensitive variant specific TaqMan based real time PCR assay applicable to RNA from formalin-fixed paraffin-embedded tissue (FFPE). MATERIALS AND METHODS: This assay was used to analyze the EML4-ALK gene in 96 non-selected NSCLC specimens and compared with two other methods (end-point PCR and break-apart FISH). RESULTS: EML4-ALK was detected in 33/96 (34%) specimens using variant specific real time PCR, whereas in only 23/96 (24%) using end-point PCR. All real time PCR positive samples were confirmed with direct sequencing. A total of 46 specimens ","Adenocarcinoma/diagnosis/*genetics, Carcinoma, Non-Small-Cell Lung/diagnosis/*genetics, Carcinoma, Squamous Cell/diagnosis/*genetics, Cell Line, Tumor, DNA Probes/chemistry, Humans, In Situ Hybridization, Fluorescence, Lung Neoplasms/diagnosis/*genetics, Molecular Diagnostic Techniqu","Robesova B, Bajerova M, Liskova K, Skrickova J, Tomiskova M, Pospisilova S, Mayer J, Dvorakova D","Lung Cancer. 2014 Jul;85(1):25-30. doi","2014 Jul","S0169-5002(14)00169-X [pii], 10.1016/j.lungcan.2014.04.002 [doi]","Lung cancer (Amsterdam, Netherlands)"
"250","26667895","Magnetic Nanoparticles PCR Enzyme-Linked Gene Assay for Quantitative","BACKGROUND: Magnetic nanoparticles (MNPs) have been widely used in medical diagnostic research. In this work, two technologies, MNPs and polymerase chain reaction (PCR), were combined to increase detection sensitivity and specificity. A novel technique based on the MNPs-PCR enzyme-linked gene assay (MELGA) was developed for detection of the BCR/ABL abnormal gene in chronic myelogenous leukemia (CML) patients. METHODS: An MNPs-labeled BCR forward primer and a biotin-labeled ABL reverse primer were used to specifically amplify the target gene. After magnetic separation, the PCR product bound to MNPs labeled with streptavidin-conjugated horseradish peroxidase was incubated with the peroxidase substrate and hydrogen peroxide to generate the colorimetric signal. RESULTS: When compared with real-time quantitative-PCR (RQ-PCR), the MELGA technique exhibited an increased sensitivity of <1 fg with high ","Adult, Animals, Cell Line, Tumor, Enzyme Assays/*methods, Female, Fusion Proteins, bcr-abl/genetics/*metabolism, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/metabolism, *Magnetite Nanoparticles, Male, Mice, Middle Aged, Polymerase Chain Reaction/methods, RNA, M","Manthawornsiri Y, Polpanich D, Yamkamon V, Thiramanas R, Hongeng S, Rerkamnuaychoke B, Jootar S, Tangboriboonrat P, Jangpatarapongsa K","J Clin Lab Anal. 2016 Sep;30(5):534-42. doi","2016 Sep","10.1002/jcla.21899 [doi]","Journal of clinical laboratory analysis"
"251","23817194","New methods for ALK status diagnosis in non-small-cell lung cancer","INTRODUCTION: The demonstration of anaplastic lymphoma kinase (ALK) positivity in non-small-cell lung cancer (NSCLC) has been hindered by the technical complexity and interpretative challenges of fluorescence in situ hybridization methods for detection of ALK gene rearrangement and by the inadequate sensitivity of existing immunohistochemistry (IHC) methods for ALK protein detection. In this study, we sought to increase the sensitivity of ALK IHC detection and to develop a brightfield assay for concurrent detection of ALK protein expression and ALK gene rearrangement. METHODS: We developed a horseradish peroxidase-based IHC detection system using the novel, nonendogenous hapten 3-hydroxy-2-quinoxaline (HQ) and tyramide. We also developed a dual gene protein ALK assay combining a brightfield break-apart in situ hybridization ALK assay with another sensitive IHC method using the novel, nonendogen","Anaplastic Lymphoma Kinase, Carcinoma, Non-Small-Cell Lung/*chemistry, Cell Line, Tumor, Haptens/immunology, Humans, Immunohistochemistry/*methods, In Situ Hybridization, Fluorescence/*methods, Lung Neoplasms/*chemistry, Receptor Protein-Tyrosine Kinases/*analysis","Nitta H, Tsuta K, Yoshida A, Ho SN, Kelly BD, Murata LB, Kosmeder J, White K, Ehser S, Towne P, Schemp C, McElhinny A, Ranger-Moore J, Bieniarz C, Singh S, Tsuda H, Grogan TM","J Thorac Oncol. 2013 Aug;8(8):1019-31. doi","2013 Aug","10.1097/JTO.0b013e31829ebb4d [doi], S1556-0864(15)33442-0 [pii]","Journal of thoracic oncology"
"252","31518872","miR-96 acts as a tumor suppressor via targeting the BCR-ABL1 oncogen","MicroRNA-mediated posttranscriptional regulation is an important epigenetic regulatory mechanism of gene expression, and its dysregulation is involved in the development and progression of a variety of malignancies, including chronic myeloid leukemia (CML). The BCR-ABL1 fusion gene is not only the initiating factor of CML, but it is also an important driving factor for blastic transformation. Tyrosine kinase inhibitors (TKIs) targeting BCR-ABL1 tyrosine kinase activity, represented by imatinib, are currently the first-line treatment for CML. However, due to primary resistance or secondary resistance caused by mutations in the BCR-ABL1 kinase domain, TKIs cannot completely prevent the progression of CML; thus, the study of BCR-ABL1 gene expression regulation is of great significance. In this study, bioinformatics analysis and our results showed that miR-96 could directly bind to the 3'UTR region","[""3' Untranslated Regions/genetics"", 'Aminopyridines/pharmacology/therapeutic use, Base Sequence, Benzamides/pharmacology/therapeutic use, Blast Crisis/*genetics/pathology, Cell Differentiation/genetics, Cell Line, Tumor, Cell Proliferation/genetics, Cell Transformation, Neoplastic/*","Huang T, Fu Y, Wang S, Xu M, Yin X, Zhou M, Wang X, Chen C","Biomed Pharmacother. 2019 Nov;119:109413. doi","2019 Nov","S0753-3322(19)32243-7 [pii], 10.1016/j.biopha.2019.109413 [doi]","Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie"
"253","27928132","Improved FRET Biosensor for the Measurement of BCR-ABL Activity in C","Although the co-development of companion diagnostics with molecular targeted drugs is desirable, truly efficient diagnostics are limited to diseases in which chromosomal translocations or overt mutations are clearly correlated with drug efficacy. Moreover, even for such diseases, few methods are available to predict whether drug administration is effective for each individual patient whose disease is expected to respond to the drug(s). We have previously developed a biosensor based on the principle of Forster resonance energy transfer to measure the activity of the tyrosine kinase BCR-ABL and its response to drug treatment in patient-derived chronic myeloid leukemia cells. The biosensor harbors CrkL, one of the major substrates of BCR-ABL, and is therefore named Pickles after phosphorylation indicator of CrkL en substrate. The efficacy of this technique as a clinical test has been demonstrated,","Adaptor Proteins, Signal Transducing/*genetics/metabolism, Amino Acid Sequence, Amino Acid Substitution, Antineoplastic Agents/*pharmacology, Biomarkers, Pharmacological/metabolism, Biosensing Techniques/*methods, Fluorescence Resonance Energy Transfer/*methods, Fusion Proteins, bcr-","Horiguchi M, Fujioka M, Kondo T, Fujioka Y, Li X, Horiuchi K, O Satoh A, Nepal P, Nishide S, Nanbo A, Teshima T, Ohba Y","Cell Struct Funct. 2017 Feb 2;42(1):15-26. doi","2017 Feb","10.1247/csf.16019 [doi]","Cell structure and function"
"254","29738763","3D culture system containing gellan gum restores oncogene dependence","The ROS1 fusion gene has been identified in approximately 1% of non-small cell lung cancer (NSCLC) cases. Several clinical studies have highlighted ROS1 as a promising therapeutic target because crizotinib, a multi-targeted drug against ROS1, ALK, and the MET proto-oncogene, has elicited remarkable responses in ROS1-rearrangements NSCLC. However, acquired resistance mediated by ROS1 kinase domain mutations has been identified and a system to assess ROS1 inhibitors for these resistant mutations is necessary for the promotion of drug development. Publicly available NSCLC cell lines harboring the ROS1 fusion gene are limited to only HCC78cells carrying SLC34A2-ROS1. This cell line exhibits resistance to ROS1 inhibitors through activation of the EGFR pathway, although the cells were established from ROS1-TKI naive pleural effusion. Here, we demonstrate that 3D culture with gellan gum can restore th","Animals, Carcinoma, Non-Small-Cell Lung/drug therapy/*genetics/metabolism/pathology, Cell Culture Techniques/methods, Cell Line, Tumor, Culture Media/*pharmacology, ErbB Receptors/metabolism, Female, Gene Expression Regulation, Neoplastic/drug effects, Gene Rearrangement/drug effects","Gong B, Oh-Hara T, Fujita N, Katayama R","Biochem Biophys Res Commun. 2018 Jun 22;501(2):527-533. doi","2018 Jun","S0006-291X(18)31080-5 [pii], 10.1016/j.bbrc.2018.05.031 [doi]","Biochemical and biophysical research communications"
"255","26291129","MAPK15 mediates BCR-ABL1-induced autophagy and regulates oncogene-de","A reciprocal translocation of the ABL1 gene to the BCR gene results in the expression of the oncogenic BCR-ABL1 fusion protein, which characterizes human chronic myeloid leukemia (CML), a myeloproliferative disorder considered invariably fatal until the introduction of the imatinib family of tyrosine kinase inhibitors (TKI). Nonetheless, insensitivity of CML stem cells to TKI treatment and intrinsic or acquired resistance are still frequent causes for disease persistence and blastic phase progression experienced in patients after initial successful therapies. Here, we investigated a possible role for the MAPK15/ERK8 kinase in BCR-ABL1-dependent autophagy, a key process for oncogene-induced leukemogenesis. In this context, we showed the ability of MAPK15 to physically recruit the oncogene to autophagic vesicles, confirming our hypothesis of a biologically relevant role for this MAP kinase in sig","Apoptosis/physiology, *Autophagy/drug effects, Carcinogenesis/drug effects/*metabolism, Cell Line, Cell Proliferation/drug effects/*physiology, Extracellular Signal-Regulated MAP Kinases/*metabolism, Fusion Proteins, bcr-abl/*metabolism, Gene Expression Regulation, Leukemic/drug effe","Colecchia D, Rossi M, Sasdelli F, Sanzone S, Strambi A, Chiariello M","Autophagy. 2015;11(10):1790-802. doi","2015","10.1080/15548627.2015.1084454 [doi]","Autophagy"
"256","29808796","Characterization of imatinib-resistant K562 cell line displaying res","Chronic myeloid leukemia (CML) is a hematopoietic malignancy characterized by the t(9; 22) and the related oncogene, BCR-ABL. Tyrosine kinase activity of fusion protein BCR-ABL is the main cause of CML. Even if imatinib is used as a tyrosine kinase inhibitor (TKI) for CML therapy, drug resistance may occur in patients and the clinical failure of imatinib treatment in resistant patients had resulted with the use of another alternative TKIs. BCR-ABL dependent and independent molecular mechanisms have crucial roles in drug resistance. To reveal the underlying molecular mechanisms which play significant roles in imatinib resistance in CML, we established K562 imatinib-resistant cell line (K562r5) which was continuously exposed to (5microM) imatinib to investigate molecular mechanisms which play significant roles in drug resistance. First of all, we analyzed T315I, M351T, F315L and F359C/L/V mutatio","Antineoplastic Agents/*pharmacology, Apoptosis/drug effects, Autophagy/drug effects, Biological Transport/drug effects, Carrier Proteins/biosynthesis/genetics, Caspases/metabolism, DNA Mutational Analysis, DNA, Neoplasm/genetics, Drug Resistance, Neoplasm/drug effects/genetics, Enzym","Hekmatshoar Y, Ozkan T, Altinok Gunes B, Bozkurt S, Karadag A, Karabay AZ, Sunguroglu A","Cell Mol Biol (Noisy-le-grand). 2018 May 15;64(6):23-30.","2018 May","?","Cellular and molecular biology (Noisy-le-Grand, France)"
"257","23233089","Downregulation of gamma-catenin inhibits CML cell growth and potenti","gamma-catenin plays different roles in different types of tumors, and its role in chronic myeloid leukemia (CML) cells has yet to be identified. In our study, two CML cell lines (K562, KU812) had higher gamma-catenin expression levels compared to five types of BCR-ABL-negative leukemia cells. Knockdown of the expression of BCR-ABL resulted in downregulation of gamma-catenin. Furthermore, downregulation of gamma-catenin by siRNA inhibited the proliferation and colony formation of CML cells and the expression of the c-Myc and cyclin D1 genes; downregulation of gamma-catenin also potentiated the effects of imatinib (inhibiting CML cell proliferation and inducing apoptosis) and suppressed the anti-apoptotic genes Bcl-xL and survivin. We also showed that downregulation of gamma-catenin suppressed the phosphorylation of STAT5, promoted the phosphorylation of beta-catenin and reduced the translocation","Active Transport, Cell Nucleus, Antineoplastic Agents/*pharmacology, Benzamides/*pharmacology, Cell Line, Tumor, Cell Proliferation/drug effects, *Down-Regulation, Fusion Proteins, bcr-abl/genetics/metabolism, Gene Expression Regulation, Leukemic, Gene Knockdown Techniques, Glycogen ","Niu CC, Zhao C, Yang ZD, Zhang XL, Wu WR, Pan J, Zhao C, Li ZQ, Ding W, Yang Z, Si WK","Int J Mol Med. 2013 Feb;31(2):453-8. doi","2013 Feb","10.3892/ijmm.2012.1207 [doi]","International journal of molecular medicine"
"258","30381447","Combined Cellular and Biochemical Profiling to Identify Predictive D","Kinase inhibitors form the largest class of precision medicine. From 2013 to 2017, 17 have been approved, with 8 different mechanisms. We present a comprehensive profiling study of all 17 inhibitors on a biochemical assay panel of 280 kinases and proliferation assays of 108 cancer cell lines. Drug responses of the cell lines were related to the presence of frequently recurring point mutations, insertions, deletions, and amplifications in 15 well-known oncogenes and tumor-suppressor genes. In addition, drug responses were correlated with basal gene expression levels with a focus on 383 clinically actionable genes. Cell lines harboring actionable mutations defined in the FDA labels, such as mutant BRAF(V600E) for cobimetinib, or ALK gene translocation for ALK inhibitors, are generally 10 times more sensitive compared with wild-type cell lines. This sensitivity window is more narrow for markers th","Cell Line, Tumor, Cell Proliferation/drug effects, Drug Approval, Drug Repositioning, Gene Expression Regulation, Neoplastic/drug effects, Humans, Neoplasms/drug therapy/*enzymology, Point Mutation, Protein Interaction Maps, Protein Kinase Inhibitors/*pharmacology, Pyrazoles/pharmaco","Uitdehaag JCM, Kooijman JJ, de Roos JADM, Prinsen MBW, Dylus J, Willemsen-Seegers N, Kawase Y, Sawa M, de Man J, van Gerwen SJC, Buijsman RC, Zaman GJR","Mol Cancer Ther. 2019 Feb;18(2):470-481. doi","2019 Feb","1535-7163.MCT-18-0877 [pii], 10.1158/1535-7163.MCT-18-0877 [doi]","Molecular cancer therapeutics"
"259","31837444","Preclinical development of a novel BCR-ABL T315I inhibitor against c","Chronic Myeloid Leukemia (CML) is a myeloproliferative neoplasm primarily due to the presence of the BCR-ABL fusion gene that produces the constitutively active protein, BCR-ABL. Imatinib, a BCR-ABL-targeted drug, is a first-line drug for the treatment of CML. Resistance to imatinib occurs as a result of mutations in the BCR-ABL kinase domains. In this study, we evaluated S116836, a novel BCR-ABL inhibitor, for its anti-cancer efficacy in the wild-type (WT) and T315I mutant BCR-ABL. S116836 was efficacious in BaF3 cells with WT or T315I mutated BCR-ABL genotypes. S116836 inhibits the phosphorylation of BCR-ABL and its downstream signaling in BaF3/WT and BaF3/T315I cells. Mechanistically, S116836 arrests the cells in the G0/G1 phase of cell cycle, induces apoptosis, increases ROS production, and decreases GSH production in BaF3/WT and BaF3/T315I cells. Moreover, in mouse tumor xenografts, S11683","?","Gupta P, Zhang GN, Barbuti AM, Zhang X, Karadkhelkar N, Zhou J, Ding K, Pan J, Yoganathan S, Yang DH, Chen ZS","Cancer Lett. 2020 Mar 1;472:132-141. doi","2020 Mar","S0304-3835(19)30606-8 [pii], 10.1016/j.canlet.2019.11.040 [doi]","Cancer letters"
"260","28855393","FGFR3-TACC3 cancer gene fusions cause mitotic defects by removal of ","Fibroblast growth factor receptor 3-transforming acidic coiled-coil containing protein 3 (FGFR3-TACC3; FT3) is a gene fusion resulting from rearrangement of chromosome 4 that has been identified in many cancers including those of the urinary bladder. Altered FGFR3 signalling in FT3-positive cells is thought to contribute to cancer progression. However, potential changes in TACC3 function in these cells have not been explored. TACC3 is a mitotic spindle protein required for accurate chromosome segregation. Errors in segregation lead to aneuploidy, which can contribute to cancer progression. Here we show that FT3-positive bladder cancer cells have lower levels of endogenous TACC3 on the mitotic spindle, and that this is sufficient to cause mitotic defects. FT3 is not localized to the mitotic spindle, and by virtue of its TACC domain, recruits endogenous TACC3 away from the spindle. Knockdown of t","Cell Line, Chromosome Segregation, Gene Expression Regulation, Neoplastic, Gene Knockdown Techniques, HeLa Cells, Humans, Microtubule-Associated Proteins/genetics/*metabolism, Mitosis, Oncogene Proteins, Fusion/*genetics/metabolism, Receptor, Fibroblast Growth Factor, Type 3/genetics","Sarkar S, Ryan EL, Royle SJ","Open Biol. 2017 Aug;7(8). pii","2017 Aug","rsob.170080 [pii], 10.1098/rsob.170080 [doi]","Open biology"
"261","29272786","Autophagy enhanced antitumor effect in K562 and K562/ADM cells using","Realgar transforming solution (RTS) can be produced from a biotransformation process by using microorganisms cultured with realgar in our lab. RTS has been demonstrated as a novel arsenic anti-leukemia agent in K562 and K562/ADM. However, its underlying mechanism is unclear. In this study, we showed that RTS could strongly induce apoptosis in K562 and K562/ADM cells. After the cells were treated by RTS, apoptotic population were increased compared to control and clearly distinguishable by DAPI nuclei staining. With increasing the dose of RTS, more cells arrested in S phase and G2/M phase. Secondly, we also showed that RTS could induce autophagy via up-regulation of LC3, p62/SQSTM1 and inhibition of mTOR in a much lower arsenic dosage in contrast to ATO and realgar. In addition, autophagy induced by RTS partially due to the degradation of fusion oncoprotein Bcr-Abl, which is associated with mult","Antineoplastic Agents/*pharmacology, Arsenicals/*pharmacology, Autophagy/*drug effects/physiology, Dose-Response Relationship, Drug, Fusion Proteins, bcr-abl/antagonists & inhibitors/metabolism, Humans, K562 Cells, Sulfides/*pharmacology","Wang X, Chen B, Zhao L, Zhi D, Hai Y, Song P, Li Y, Xie Q, Inam U, Wu Z, Yu L, Li H","Biomed Pharmacother. 2018 Feb;98:252-264. doi","2018 Feb","S0753-3322(17)34673-5 [pii], 10.1016/j.biopha.2017.12.038 [doi]","Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie"
"262","16946300","Phosphotyrosine profiling identifies the KG-1 cell line as a model f","The 8p11 myeloproliferative syndrome (EMS) is associated with translocations that disrupt the FGFR1 gene. To date, 8 fusion partners of FGFR1 have been identified. However, no primary leukemia cell lines were identified that contain any of these fusions. Here, we screened more than 40 acute myeloid leukemia cell lines for constitutive phosphorylation of STAT5 and applied an immunoaffinity profiling strategy to identify tyrosine-phosphorylated proteins in the KG-1 cell line. Mass spectrometry analysis of KG-1 cells revealed aberrant tyrosine phosphorylation of FGFR1. Subsequent analysis led to the identification of a fusion of the FGFR1OP2 gene to the FGFR1 gene. Small interfering RNA (siRNA) against FGFR1 specifically inhibited the growth and induced apoptosis of KG-1 cells. Thus, the KG-1 cell line provides an in vitro model for the study of FGFR1 fusions associated with leukemia and for the a","Apoptosis/*genetics, Cell Line, Tumor, Humans, Leukemia, Myeloid, Acute/*genetics/metabolism, *Models, Biological, Oncogene Proteins, Fusion/*biosynthesis/genetics, Proto-Oncogene Proteins/biosynthesis/*genetics, RNA, Small Interfering/genetics/pharmacology, Receptor, Fibroblast Grow","Gu TL, Goss VL, Reeves C, Popova L, Nardone J, Macneill J, Walters DK, Wang Y, Rush J, Comb MJ, Druker BJ, Polakiewicz RD","Blood. 2006 Dec 15;108(13):4202-4. doi","2006 Dec","blood-2006-06-026666 [pii], 10.1182/blood-2006-06-026666 [doi]","Blood"
"263","28401599","FOXM1 Transcription Factor","FOXM1 transcription factor is a central component of tumor initiation, growth, and progression due to its multiple effects on cell cycle, DNA repair, angiogenesis and invasion, chromatin, protein anabolism, and cell adhesion. Moreover, FOXM1 interacts with beta-catenin promoting its nuclear import and transcriptional activation. Here, we show that FOXM1 is involved in the advantage of chronic myeloid leukemia hematopoiesis over the normal counterpart. FOXM1 hyper-activation associated with BCR-ABL1 results from phosphorylation by the fusion protein kinase-dependent activation of Polo-like kinase 1. FOXM1 phosphorylation lets its binding with beta-catenin and beta-catenin transcriptional activation, a key event for persistence of the leukemic stem cell compartment under tyrosine kinase inhibitor therapy. Polo-like kinase 1 inhibitor BI6727, already advanced for clinical use, breaks beta-catenin ","*Cell Proliferation, Female, Forkhead Box Protein M1/genetics/*metabolism, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/drug therapy/genetics/*metabolism/pathology, Male, Neoplasm Proteins/genetics/*metabolism, Neoplastic Stem Cells/*metabolism/pathology, *Sig","Mancini M, Castagnetti F, Soverini S, Leo E, De Benedittis C, Gugliotta G, Rosti G, Bavaro L, De Santis S, Monaldi C, Martelli M, Santucci MA, Cavo M, Martinelli G","J Cell Biochem. 2017 Nov;118(11):3968-3975. doi","2017 Nov","10.1002/jcb.26052 [doi]","Journal of cellular biochemistry"
"264","28533480","Deregulated expression of miR-29a-3p, miR-494-3p and miR-660-5p affe","The development of Imatinib mesylate (IM), which targets the oncogenic BCR-ABL fusion protein, has greatly improved the outcome of Chronic Myeloid Leukemia (CML) patients. However, BCR-ABL-positive progenitors can be detected in CML patients in complete cytogenetic response. Several evidence suggests that CML stem cells are intrinsically resistant to Tyrosine Kinase Inhibitors (TKI), and therefore they represent the most likely candidate responsible for disease relapse.In this work, we investigated the microRNA (miRNA) expression profile of different subpopulations of CML Leukemic Stem Cells (LSCs): Lin-CD34+CD38- and Lin-CD34-CD38- cells. These cell fractions have been previously shown to be endowed with TKI intrinsic resistance. Our analysis identified 33 common deregulated miRNAs in CML LSCs. Among those, 8 miRNAs were deregulated in CML independently from BCR-ABL kinase activity and therefo","[""3' Untranslated Regions"", 'Antineoplastic Agents/pharmacology, Apoptosis/drug effects/genetics, Basic Helix-Loop-Helix Transcription Factors/genetics, Cell Line, Tumor, DNA-Binding Proteins/genetics, Drug Resistance, Neoplasm/*genetics, Fusion Proteins, bcr-abl/genetics, Gene Expre","Salati S, Salvestrini V, Carretta C, Genovese E, Rontauroli S, Zini R, Rossi C, Ruberti S, Bianchi E, Barbieri G, Curti A, Castagnetti F, Gugliotta G, Rosti G, Bergamaschi M, Tafuri A, Tagliafico E, Lemoli R, Manfredini R","Oncotarget. 2017 Jul 25;8(30):49451-49469. doi","2017 Jul","17706 [pii], 10.18632/oncotarget.17706 [doi]","Oncotarget"
"265","30593760","Vitamin capital IE, Cyrillic activates expression of capital ES, Cyr","BACKGROUND: Chronic myeloid leukemia (CML) is a clonal hematopoietic stem cell disorder associated with the activity of BCR-ABL fusion oncogene. Tyrosine kinase inhibitors are the current treatment of CML, but secondary mutations finally contribute to therapy resistance and blast crisis of the disease. The search for the novel compounds for the effective control of CML is now in the spotlight. The progression of CML to blast crisis is correlated with down-modulation of C/EBP alpha. Therefore, C/EBP alpha may be considered as a putative target in differentiation therapies in myeloid leukemias. The aim of the study was to assess the potential of vitamin E as the possible inducer of C/EBP alpha expression in BCR-ABL-positive CML K562 cells. MATERIALS AND METHODS: RNA extracted from K562 cells cultured with valproic acid or vitamin E was converted to cDNA, RT-PCR reactions were carried out using Ho","Antineoplastic Agents/*pharmacology, CCAAT-Enhancer-Binding Protein-alpha/biosynthesis/*genetics, Cell Line, Tumor, Fusion Proteins, bcr-abl/genetics, Gene Expression Regulation, Leukemic, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/metabolism, Rece","Shvachko LP, Zavelevich MP, Gluzman DF, Kravchuk IV, Telegeev GD","Exp Oncol. 2018 Dec;40(4):328-331.","2018 Dec","11958 [pii]","Experimental oncology"
"266","27885740","ASP5878, a selective FGFR inhibitor, to treat FGFR3-dependent urothe","FGF/FGFR gene aberrations such as amplification, mutation and fusion are associated with many types of human cancers including urothelial cancer. FGFR kinase inhibitors are expected to be a targeted therapy for urothelial cancer harboring FGFR3 gene alternations. ASP5878, a selective inhibitor of FGFR1, 2, 3 and 4 under clinical investigation, selectively inhibited cell proliferation of urothelial cancer cell lines harboring FGFR3 point mutation or fusion (UM-UC-14, RT-112, RT4 and SW 780) among 23 urothelial cancer cell lines. Furthermore, ASP5878 inhibited cell proliferation of adriamycin-resistant UM-UC-14 cell line harboring MDR1 overexpression and gemcitabine-resistant RT-112 cell line. The protein expression of c-MYC, an oncoprotein, in gemcitabine-resistant RT-112 cell line was higher than that in RT-112 parental cell line and ASP5878 decreased the c-MYC expression in both RT-112 parenta","ATP Binding Cassette Transporter, Subfamily B/metabolism, Antineoplastic Agents/pharmacology, Body Weight/drug effects, Cell Line, Tumor, Cell Proliferation/drug effects, DNA-Binding Proteins/metabolism, Deoxycytidine/analogs & derivatives/pharmacology, Doxorubicin/pharmacology, Drug","Kikuchi A, Suzuki T, Nakazawa T, Iizuka M, Nakayama A, Ozawa T, Kameda M, Shindoh N, Terasaka T, Hirano M, Kuromitsu S","Cancer Sci. 2017 Feb;108(2):236-242. doi","2017 Feb","10.1111/cas.13124 [doi]","Cancer science"
"267","28162770","Gene Essentiality Profiling Reveals Gene Networks and Synthetic Leth","The genetic dependencies of human cancers widely vary. Here, we catalog this heterogeneity and use it to identify functional gene interactions and genotype-dependent liabilities in cancer. By using genome-wide CRISPR-based screens, we generate a gene essentiality dataset across 14 human acute myeloid leukemia (AML) cell lines. Sets of genes with correlated patterns of essentiality across the lines reveal new gene relationships, the essential substrates of enzymes, and the molecular functions of uncharacterized proteins. Comparisons of differentially essential genes between Ras-dependent and -independent lines uncover synthetic lethal partners of oncogenic Ras. Screens in both human AML and engineered mouse pro-B cells converge on a surprisingly small number of genes in the Ras processing and MAPK pathways and pinpoint PREX1 as an AML-specific activator of MAPK signaling. Our findings suggest ge","Animals, Carrier Proteins, Cell Line, Tumor, Clustered Regularly Interspaced Short Palindromic Repeats, Epigenesis, Genetic, *Gene Regulatory Networks, Genes, Essential, Humans, Leukemia, Myeloid, Acute/*genetics, MAP Kinase Signaling System, Mice, Mitochondrial Proteins, Protein Pro","Wang T, Yu H, Hughes NW, Liu B, Kendirli A, Klein K, Chen WW, Lander ES, Sabatini DM","Cell. 2017 Feb 23;168(5):890-903.e15. doi","2017 Feb","S0092-8674(17)30061-2 [pii], 10.1016/j.cell.2017.01.013 [doi]","Cell"
"268","25536607","Synergistic effect of ponatinib and epigallocatechin-3-gallate induc","PURPOSE: Ponatinib (P) has been used for the treatment of chronic myeloid leukemia (CML) and it is known that inhibition of BCR-ABL fusion protein by ponatinib induces apoptosis of CML cells. Epigallocatechin-3-gallate (EGCG), which is a polyphenol in green tea, induces apoptosis in different types of cancer cells. The purpose of this study was to determine the cytotoxic and apoptotic effects of ponatinib and EGCG combination in K562 CML cell line. This study also aimed to detect alterations of the expression levels of cell cycle-regulation related genes after ponatinib and EGCG combination in K562 CML cell line. METHODS: The cytotoxic effects of the compounds on K562 cells were determined in a time-and dose-dependent manner by using WST-1 analysis. The combination index (CI) isobologram was used to analyze the data. Apoptotic effects of P-EGCG were defined by flow cytometry and gene expression","Antineoplastic Agents/*pharmacology, *Apoptosis, Catechin/*analogs & derivatives/pharmacology, Cell Cycle/*genetics, Fusion Proteins, bcr-abl, Gene Expression/drug effects, Humans, Imidazoles/*pharmacology, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics, Pyrid","Goker B, Caliskan C, Onur Caglar H, Kayabasi C, Balci T, Erbaykent Tepedelen B, Aygunes D, Yilmaz Susluer S, Mutlu Z, Selvi Gunel N, Korkmaz M, Saydam G, Gunduz C, Biray Avci C","J BUON. 2014 Oct-Dec;19(4):992-8.","2014 Oct","?","Journal of B.U.ON."
"269","24736545","Activation of SOX2 expression by BRD4-NUT oncogenic fusion drives ne","BRD4 is implicated in the pathogenesis of a number of different cancers. It is also the target of translocation t(15;19) that accounts for the highly aggressive NUT midline carcinoma (NMC). We discovered that t(15;19) NMC cells display the ability to grow into stem cell-like spheres and express an exceptionally high level of the stem cell marker, SOX2. The BRD4-NUT fusion oncogene resulting from t(15;19) translocation is required for the abnormal activation of SOX2, which drives the stem cell-like proliferation and cellular transformation in NMC cells. SOX2 knockdown phenocopies the effects of BRD4-NUT inhibition, whereas ectopic SOX2 expression rescues the phenotype. The BRD4-NUT-induced abnormal SOX2 activation was observed in multiple NMC cell lines as well as in NMC primary tumors. We further demonstrate that BRD4-NUT oncoprotein recruits p300 to stimulate transcription activation and that ","Antineoplastic Agents/pharmacology, Azepines/pharmacology, Carcinoma, Squamous Cell/genetics/*metabolism/pathology, Cell Line, Tumor, Cell Transformation, Neoplastic/genetics/*metabolism, Gene Expression Regulation, Neoplastic, Humans, Nuclear Proteins/*physiology, Oncogene Proteins,","Wang R, Liu W, Helfer CM, Bradner JE, Hornick JL, Janicki SM, French CA, You J","Cancer Res. 2014 Jun 15;74(12):3332-43. doi","2014 Jun","0008-5472.CAN-13-2658 [pii], 10.1158/0008-5472.CAN-13-2658 [doi]","Cancer research"
"270","24657894","Studying the enhancement of programmed cell death by combined AG1024","AIMS: Chronic myelogenous leukemia is a clonal malignancy of the pluripotent hematopoietic stem cells that is characterized by the uncontrolled proliferation and expansion of myeloid progenitors. Myeloid progenitors express the fusion oncogene BCR-ABL, which has uncontrollable activity in malignant cells and prevents the cell apoptosis caused by some antineoplastic agents, such as paclitaxel. Targeting these abnormalities by blocking the tyrosine kinase enzymes of BCR-ABL is a promising approach for chronic myelogenous leukemia therapy. MAIN METHODS: Conventional Liu's staining is an auxiliary technique used in microscopy to enhance the contrast in microscopic images, aiding the observation of cell morphology. The MTT assay, flow cytometry of the sub-G1 analysis and the TUNEL assay were applied to estimate the apoptosis levels. RT-PCR and western blot methods were used to evaluate the key molec","Antineoplastic Agents, Phytogenic/*administration & dosage, Apoptosis/*drug effects/physiology, Drug Delivery Systems/methods, Drug Therapy, Combination, Humans, K562 Cells, *Leukemia, Myelogenous, Chronic, BCR-ABL Positive/drug therapy/pathology, Paclitaxel/*administration & dosage,","Cheng HY, Ko FH","Life Sci. 2014 May 2;102(2):118-26. doi","2014 May","S0024-3205(14)00339-7 [pii], 10.1016/j.lfs.2014.03.014 [doi]","Life sciences"
"271","28881484","Primary cells in BCR/FGFR1-positive 8p11 myeloproliferative syndrome","OBJECTIVES: Translocations involving the fibroblast growth factor receptor 1 (FGFR1) gene are associated with the 8p11 myeloproliferative syndrome (EMS), a rare neoplasm that following a usually short chronic phase progresses into acute myeloid or lymphoid leukemia. The treatment commonly involves chemotherapy and, if possible, allogeneic stem cell transplantation which is the only therapeutic option for long-term survival. Given the aggressive course of EMS, we here evaluated tyrosine kinase inhibitors as treatment options to delay disease progression. METHODS: We described a new case of EMS and used chromosome analyses, PCR, and sequencing to investigate the underlying genetic aberrations. The sensitivity to several tyrosine kinase inhibitors was tested in vitro on the EMS cell line KG1 and on primary cells from the newly diagnosed EMS patient. RESULTS: A translocation involving chromosomes 8","Benzimidazoles/*pharmacology, *Chromosomes, Human, Pair 8, Dasatinib/*pharmacology, Humans, Imidazoles/*pharmacology, Inhibitory Concentration 50, Male, Myeloproliferative Disorders/diagnosis/*genetics, Protein Kinase Inhibitors/pharmacology, Proto-Oncogene Proteins c-bcr/*genetics, ","Landberg N, Dreimane A, Rissler M, Billstrom R, Agerstam H","Eur J Haematol. 2017 Nov;99(5):442-448. doi","2017 Nov","10.1111/ejh.12957 [doi]","European journal of haematology"
"272","27738334","Efficacy of crizotinib and pemetrexed-based chemotherapy in Chinese ","BACKGROUND: ROS1 rearrangement is a novel molecular subgroup of non-small-cell lung cancer (NSCLC). This study aimed to investigate the efficacy of crizotinib and pemetrexed-based chemotherapy in Chinese NSCLC patients with ROS1 rearrangement. RESULTS: A total of 2309 patients received ROS1 fusion detection and 51(2.2%) patients had ROS1 rearrangement. There was no significant difference between ROS1 fusion-positive and fusion-negative cohorts in demographic data. For the ROS1 fusion-positive patients, crizotinb-treated group had a higher overall response rate (ORR, 80.0%), disease control rate (DCR, 90.0%) and longer progression-free survival (PFS, 294 days) compared with the rates in pemetrexed-treated group (ORR, 40.8%; DCR, 71.4%; PFS, 179 days) and non-pemetrexed-treated group (ORR, 25.0%; DCR, 47.7%; PFS, 110 days). Besides, ORR, DCR and PFS were similar in three major ROS1 fusion partner","Adult, Aged, Aged, 80 and over, Antineoplastic Combined Chemotherapy Protocols/adverse effects/therapeutic use, Carcinoma, Non-Small-Cell Lung/diagnosis/*drug therapy/*genetics/mortality, China, Crizotinib, Female, Humans, Lung Neoplasms/diagnosis/*drug therapy/*genetics/mortality, M","Zhang L, Jiang T, Zhao C, Li W, Li X, Zhao S, Liu X, Jia Y, Yang H, Ren S, Zhou C","Oncotarget. 2016 Nov 15;7(46):75145-75154. doi","2016 Nov","12612 [pii], 10.18632/oncotarget.12612 [doi]","Oncotarget"
"273","25485619","A comprehensive transcriptional portrait of human cancer cell lines.","Tumor-derived cell lines have served as vital models to advance our understanding of oncogene function and therapeutic responses. Although substantial effort has been made to define the genomic constitution of cancer cell line panels, the transcriptome remains understudied. Here we describe RNA sequencing and single-nucleotide polymorphism (SNP) array analysis of 675 human cancer cell lines. We report comprehensive analyses of transcriptome features including gene expression, mutations, gene fusions and expression of non-human sequences. Of the 2,200 gene fusions catalogued, 1,435 consist of genes not previously found in fusions, providing many leads for further investigation. We combine multiple genome and transcriptome features in a pathway-based approach to enhance prediction of response to targeted therapeutics. Our results provide a valuable resource for studies that use cancer cell lines.","Base Sequence, Cell Line, Tumor, Cluster Analysis, Gene Expression Regulation, Neoplastic, Gene Regulatory Networks, Humans, Mutation/genetics, Neoplasms/*genetics, Oncogene Fusion/genetics, Organ Specificity/genetics, Polymorphism, Single Nucleotide/genetics, *Transcription, Genetic","Klijn C, Durinck S, Stawiski EW, Haverty PM, Jiang Z, Liu H, Degenhardt J, Mayba O, Gnad F, Liu J, Pau G, Reeder J, Cao Y, Mukhyala K, Selvaraj SK, Yu M, Zynda GJ, Brauer MJ, Wu TD, Gentleman RC, Manning G, Yauch RL, Bourgon R, Stokoe D, Modrusan Z, Neve RM, de Sauvage FJ, Settleman J, Seshagiri S, Zhang Z","Nat Biotechnol. 2015 Mar;33(3):306-12. doi","2015 Mar","nbt.3080 [pii], 10.1038/nbt.3080 [doi]","Nature biotechnology"
"274","18089786","MUC1 oncoprotein regulates Bcr-Abl stability and pathogenesis in chr","Chronic myelogenous leukemia (CML) results from expression of the Bcr-Abl fusion protein in hematopoietic stem cells. The MUC1 heterodimeric protein is aberrantly overexpressed in diverse human carcinomas. The present studies show that MUC1 is expressed in the human K562 and KU812 CML cell lines. The results show that MUC1 associates with Bcr-Abl through a direct interaction between the Bcr N-terminal region and the MUC1 cytoplasmic domain. Stable silencing of MUC1 decreased cytoplasmic Bcr-Abl levels by promoting Bcr-Abl degradation. Silencing MUC1 was also associated with decreases in K562 and KU812 cell self-renewal capacity and with a more differentiated erythroid phenotype. The results further show that silencing MUC1 increases sensitivity of CML cells to imatinib-induced apoptosis. Analysis of primary CML blasts confirmed that, as found with the CML cell lines, MUC1 blocks differentiation","Apoptosis, Cell Differentiation, Cell Line, Tumor, Fusion Proteins, bcr-abl/*genetics, Gene Silencing, Glutathione, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/*physiopathology, Lymphoma, Mucin-1/*genetics/metabolism, RNA, Neoplasm/genetics, Reverse","Kawano T, Ito M, Raina D, Wu Z, Rosenblatt J, Avigan D, Stone R, Kufe D","Cancer Res. 2007 Dec 15;67(24):11576-84. doi","2007 Dec","67/24/11576 [pii], 10.1158/0008-5472.CAN-07-2756 [doi]","Cancer research"
"275","28390196","PI3K isoform inhibition associated with anti Bcr-Abl drugs shows in ","B-acute lymphoblastic leukemia (B-ALL) is a malignant disorder characterized by the abnormal proliferation of B-cell progenitors. Philadelphia chromosome-positive (Ph+) B-ALL is a subtype that expresses the Bcr-Abl fusion protein which represents a negative prognostic factor. Constitutive activation of the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin (PI3K/Akt/mTOR) network is a common feature of B-ALL, influencing cell growth and survival. In the present study, we aimed to investigate the efficacy of PI3K isoform inhibition in B-ALL cell lines harboring the Bcr-Abl fusion protein.We studied the effects of anti Bcr-Abl drugs Imatinib, Nilotinib and GZD824 associated with PI3K isoform inhibitors. We used a panel of six compounds which specifically target PI3K isoforms including the pan-PI3K inhibitor ZSTK474, p110alpha BYL719 inhibitor and the dual p110gamma/p110delta inhibito","Antineoplastic Combined Chemotherapy Protocols/*pharmacology/therapeutic use, Apoptosis/drug effects, Benzamides/administration & dosage/pharmacology, Cell Line, Tumor, Cell Proliferation/drug effects, Drug Resistance, Neoplasm/drug effects, Drug Synergism, Fusion Proteins, bcr-abl/*","Ultimo S, Simioni C, Martelli AM, Zauli G, Evangelisti C, Celeghini C, McCubrey JA, Marisi G, Ulivi P, Capitani S, Neri LM","Oncotarget. 2017 Apr 4;8(14):23213-23227. doi","2017 Apr","15542 [pii], 10.18632/oncotarget.15542 [doi]","Oncotarget"
"276","31572036","Profile of entrectinib and its potential in the treatment of ROS1-po","ROS1 inhibition provides impressive survival benefits in ROS1-rearranged non-small cell lung cancer (NSCLC) patients. Crizotinib is the only tyrosine kinase inhibitor (TKI) approved by both FDA and EMA for the treatment of ROS1-positive lung cancer. In addition, several TKI have been tested with preliminary proofs of success in this oncogene-driven disease, either in the post-crizotinib setting or as first-line targeted agents. Here we present the evidence concerning entrectinib, an ALK/ROS1/NTRK inhibitor developed across different tumor types harboring rearrangements in these genes, in the context of ROS1-driven NSCLC. Of interest, in August 2019 entrectinib was granted by FDA accelerated approval for the treatment of ROS1-rearranged NSCLC, as well as of NTRK-driven solid tumors.","?","Facchinetti F, Friboulet L","Lung Cancer (Auckl). 2019 Sep 9;10:87-94. doi","2019","10.2147/LCTT.S190786 [doi], 190786 [pii]","Lung Cancer (Auckland, N.Z.)"
"277","30538120","Differential Subcellular Localization Regulates Oncogenic Signaling ","Chromosomal rearrangements involving receptor tyrosine kinases (RTK) are a clinically relevant oncogenic mechanism in human cancers. These chimeric oncoproteins often contain the C-terminal kinase domain of the RTK joined in cis to various N-terminal, nonkinase fusion partners. The functional role of the N-terminal fusion partner in RTK fusion oncoproteins is poorly understood. Here, we show that distinct N-terminal fusion partners drive differential subcellular localization, which imparts distinct cell signaling and oncogenic properties of different, clinically relevant ROS1 RTK fusion oncoproteins. SDC4-ROS1 and SLC34A2-ROS1 fusion oncoproteins resided on endosomes and activated the MAPK pathway. CD74-ROS1 variants that localized instead to the endoplasmic reticulum (ER) showed compromised activation of MAPK. Forced relocalization of CD74-ROS1 from the ER to endosomes restored MAPK signaling.","Adenocarcinoma of Lung/enzymology/genetics/*metabolism/pathology, Animals, Antigens, CD/genetics/metabolism, Endosomes/metabolism, HEK293 Cells, Humans, Lung Neoplasms/genetics/*metabolism/pathology, MAP Kinase Signaling System, Mice, Mice, Inbred NOD, Mice, SCID, NIH 3T3 Cells, Onco","Neel DS, Allegakoen DV, Olivas V, Mayekar MK, Hemmati G, Chatterjee N, Blakely CM, McCoach CE, Rotow JK, Le A, Karachaliou N, Rosell R, Riess JW, Nichols R, Doebele RC, Bivona TG","Cancer Res. 2019 Feb 1;79(3):546-556. doi","2019 Feb","0008-5472.CAN-18-1492 [pii], 10.1158/0008-5472.CAN-18-1492 [doi]","Cancer research"
"278","24112092","Mammalian target of rapamycin inhibitor rapamycin enhances anti-leuk","BCR-ABL fusion gene typically causes a type of acute lymphoblastic leukemia (ALL), known as Ph+ ALL. Although imatinib (IM) treatment induced high rates of complete response (CR), serious acute and late complications are frequent, whereas more vexatiously resistance to chemotherapy and clinical relapse develops. Therefore, the efficacy of treatment in Ph+ ALL is still to be determined. In this study, we focused our attention on the potential benefit of rapamycin (RAPA), an mammalian target of rapamycin (mTOR) inhibitor, in combination with IM on a Ph+ ALL cell line SUP-B15 and a primary Ph+ ALL sample in vitro. Analysis of cell proliferation showed that RAPA (50 nm) plus IM exerted good synergistic effect on Ph+ ALL cells. Notably, we found that IM treatment induced the abnormal activation of the components of mTOR signaling pathway and p-BCR-ABL, whereas RAPA potently eliminated this deleterio","Antineoplastic Agents/pharmacology/therapeutic use, Apoptosis/drug effects, Benzamides/*pharmacology/therapeutic use, Cell Line, Tumor, Cell Proliferation/drug effects, Dose-Response Relationship, Drug, Drug Synergism, G1 Phase Cell Cycle Checkpoints/drug effects, Humans, Imatinib Me","Yang X, He G, Gong Y, Zheng B, Shi F, Shi R, Yang X","Eur J Haematol. 2014 Feb;92(2):111-20. doi","2014 Feb","10.1111/ejh.12202 [doi]","European journal of haematology"
"279","26582603","Hyaluronan oligomers sensitize chronic myeloid leukemia cell lines t","Chronic myeloid leukemia is a myeloproliferative syndrome characterized by the presence of the Philadelphia chromosome (Ph), generated by a reciprocal translocation occurring between chromosomes 9 and 22 [t(9;22)(q34;q11)]. As a consequence, a fusion gene (bcr-abl) encoding a constitutively active kinase is generated. The first-line treatment consists on BCR-ABL inhibitors such as Imatinib, Nilotinib and Dasatinib. Nevertheless, such treatment may lead to the selection of resistant cells. Therefore, finding molecules that enhance the anti-proliferative effect of first-line drugs is of value. Hyaluronan oligomers (oHA) are known to be able to sensitize several tumor cells to chemotherapy. We have previously demonstrated that oHA can revert Vincristine resistance in mouse lymphoma and human leukemia cell lines. However, little is known about the role of oHA in hematological malignancies. The aim ","Animals, Apoptosis/drug effects, Cell Line, Tumor, Cellular Senescence/drug effects, Cytoprotection/drug effects, Drug Resistance, Neoplasm/*drug effects, Fusion Proteins, bcr-abl/genetics, Gene Expression Regulation, Leukemic/drug effects, Humans, Hyaluronic Acid/*administration & d","Lompardia SL, Diaz M, Papademetrio DL, Mascaro M, Pibuel M, Alvarez E, Hajos SE","Glycobiology. 2016 Apr;26(4):343-52. doi","2016 Apr","cwv107 [pii], 10.1093/glycob/cwv107 [doi]","Glycobiology"
"280","27730241","Deciphering the cross-talking of human competitive endogenous RNAs i","Chronic myelogenous leukemia (CML) is a myeloproliferative disorder characterized by increased proliferation or abnormal accumulation of granulocytic cell line without the depletion of their capacity to differentiate. A reciprocal chromosomal translocation proceeding to the 'Philadelphia chromosome', involving the ABL proto-oncogene and BCR gene residing on Chromosome 9 and 22 respectively, is observed to be attributed to CML pathogenesis. Recent studies have been unraveling the crucial role of genomic 'dark matter' or the non-coding repertoire in cancer initiation and progression. The intricate cross-talk between competitive endogenous RNAs (ceRNAs) provides a scaffold to systematically functionalize the miRNA response element harboring non-coding RNAs and incorporate them with the protein-coding RNA dimension in complex ceRNA networks. This network of coding and non-coding transcriptome linke","Databases, Nucleic Acid, Disease Progression, Gene Expression Profiling, *Gene Expression Regulation, Leukemic, Gene Regulatory Networks, High-Throughput Nucleotide Sequencing, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/pathology, MicroRNAs/genetic","Sen K, Sarkar A, Maji RK, Ghosh Z, Gupta S, Ghosh TC","Mol Biosyst. 2016 Nov 15;12(12):3633-3642. doi","2016 Nov","10.1039/c6mb00568c [doi]","Molecular bioSystems"
"281","25006129","PIM inhibitors target CD25-positive AML cells through concomitant su","Postchemotherapy relapse presents a major unmet medical need in acute myeloid leukemia (AML), where treatment options are limited. CD25 is a leukemic stem cell marker and a conspicuous prognostic marker for overall/relapse-free survival in AML. Rare occurrence of genetic alterations among PIM family members imposes a substantial hurdle in formulating a compelling patient stratification strategy for the clinical development of selective PIM inhibitors in cancer. Here we show that CD25, a bona fide STAT5 regulated gene, is a mechanistically relevant predictive biomarker for sensitivity to PIM kinase inhibitors. Alone or in combination with tyrosine kinase inhibitors, PIM inhibitors can suppress STAT5 activation and significantly shorten the half-life of MYC to achieve substantial growth inhibition of high CD25-expressing AML cells. Our results highlight the importance of STAT5 and MYC in renderin","Antineoplastic Agents/chemistry/*pharmacology, *Blast Crisis/drug therapy/genetics/metabolism/pathology, Female, Gene Expression Regulation, Leukemic/*drug effects, HL-60 Cells, Humans, Interleukin-2 Receptor alpha Subunit/genetics/*metabolism, Leukemia, Myeloid, Acute/drug therapy/g","Guo Z, Wang A, Zhang W, Levit M, Gao Q, Barberis C, Tabart M, Zhang J, Hoffmann D, Wiederschain D, Rocnik J, Sun F, Murtie J, Lengauer C, Gross S, Zhang B, Cheng H, Patel V, Schio L, Adrian F, Dorsch M, Garcia-Echeverria C, Huang SM","Blood. 2014 Sep 11;124(11):1777-89. doi","2014 Sep","blood-2014-01-551234 [pii], 10.1182/blood-2014-01-551234 [doi]","Blood"
"282","29142066","Characterization of SGN-CD123A, A Potent CD123-Directed Antibody-Dru","Treatment choices for acute myelogenous leukemia (AML) patients resistant to conventional chemotherapies are limited and novel therapeutic agents are needed. IL3 receptor alpha (IL3Ralpha, or CD123) is expressed on the majority of AML blasts, and there is evidence that its expression is increased on leukemic relative to normal hematopoietic stem cells, which makes it an attractive target for antibody-based therapy. Here, we report the generation and preclinical characterization of SGN-CD123A, an antibody-drug conjugate using the pyrrolobenzodiazepine dimer (PBD) linker and a humanized CD123 antibody with engineered cysteines for site-specific conjugation. Mechanistically, SGN-CD123A induces activation of DNA damage response pathways, cell-cycle changes, and apoptosis in AML cells. In vitro, SGN-CD123A-mediated potent cytotoxicity of 11/12 CD123(+) AML cell lines and 20/23 primary samples from A","Animals, Antibodies, Monoclonal/immunology, CHO Cells, Cell Line, Tumor, Cricetulus, Humans, Immunoconjugates/immunology/*pharmacology, Interleukin-3 Receptor alpha Subunit/*immunology, Leukemia, Myeloid, Acute/*drug therapy/immunology, Mice, Mice, SCID, THP-1 Cells, Xenograft Model ","Li F, Sutherland MK, Yu C, Walter RB, Westendorf L, Valliere-Douglass J, Pan L, Cronkite A, Sussman D, Klussman K, Ulrich M, Anderson ME, Stone IJ, Zeng W, Jonas M, Lewis TS, Goswami M, Wang SA, Senter PD, Law CL, Feldman EJ, Benjamin DR","Mol Cancer Ther. 2018 Feb;17(2):554-564. doi","2018 Feb","1535-7163.MCT-17-0742 [pii], 10.1158/1535-7163.MCT-17-0742 [doi]","Molecular cancer therapeutics"
"283","28356934","A malignant inflammatory myofibroblastic tumor of the hypopharynx ha","Inflammatory myofibroblastic tumors (IMT) in the head and neck region are rare neoplasms that generally mimic benign/low-grade neoplasms. Overexpression of anaplastic lymphoma kinase (ALK) has been reported in 50% of IMT cases, secondary to ALK activation by structural rearrangements in the ALK gene, which results in a fusion protein with echinoderm microtubule associated protein like 4 (EML4) in ~20% of cases. The present study describes a case of a 74-year-old woman with a malignant IMT in the right posterior hypopharynx harboring a previously unreported chromosomal rearrangement resulting in EML4 and ALK gene fusion. Strong ALK immunoreactivity was observed in neoplastic cells, while fluorescent in situ hybridization combined with fluorescent fragment analysis and direct sequencing identified the first case of the 3a/b variants of the EML4-ALK fusion gene in IMT. The results of the current s","?","Muscarella LA, Rossi G, Trombetta D, La Torre A, Di Candia L, Mengoli MC, Sparaneo A, Fazio VM, Graziano P","Oncol Lett. 2017 Feb;13(2):593-598. doi","2017 Feb","10.3892/ol.2016.5504 [doi], OL-0-0-5504 [pii]","Oncology letters"
"284","24968304","Inhibition of MDM2 by nilotinib contributes to cytotoxicity in both ","Nilotinib is a selective BCR-ABL tyrosine kinase inhibitor related to imatinib that is more potent than imatinib. Nilotinib is widely used to treat chronic myelogenous leukemia (CML) and Philadelphia-positive (Ph+) acute lymphoblastic leukemia (ALL). The present study identifies Mouse double minute 2 homolog (MDM2) as a target of nilotinib. In studying ALL cell lines, we found that the expression of MDM2 in both Philadelphia positive (Ph+) and Philadelphia negative (Ph-) ALL cells was remarkably inhibited by nilotinib, in a dose- and time-dependent manner. Further studies demonstrated that nilotinib inhibited MDM2 at the post-translational level by inducing MDM2 self-ubiquitination and degradation. Nilotinib-mediated MDM2 downregulation did not result in accumulation and activation of p53. Inhibition of MDM2 in nilotinib-treated ALL cells led to downregulation of the anti-apoptotic protein X-li","Antineoplastic Agents/*pharmacology/toxicity, Apoptosis/drug effects, Cell Line, Tumor, Fusion Proteins, bcr-abl/antagonists & inhibitors/*genetics, Gene Expression Regulation, Leukemic/drug effects, Humans, Precursor Cell Lymphoblastic Leukemia-Lymphoma/drug therapy/*genetics/*metab","Zhang H, Gu L, Liu T, Chiang KY, Zhou M","PLoS One. 2014 Jun 26;9(6):e100960. doi","2014","10.1371/journal.pone.0100960 [doi], PONE-D-14-10590 [pii]","PloS one"
"285","24486291","Crizotinib (PF-2341066) induces apoptosis due to downregulation of p","Nucleophosmin-anaplastic lymphoma kinase (NPM-ALK) is an aberrant fusion gene product with tyrosine kinase activity and is expressed in substantial subset of anaplastic large cell lymphomas (ALCL). It has been shown that NPM-ALK binds to and activates signal transducer and activator of transcription 3 (STAT3). Although NPM-ALK(+) ALCL overall shows a better prognosis, there is a sub-group of patients who relapses and is resistant to conventional chemotherapeutic regimens. NPM-ALK is a potential target for small molecule kinase inhibitors. Crizotinib (PF-2341066) is a small, orally bioavailable molecule that inhibits growth of tumors with ALK activity as shown in a subgroup of non-small lung cancer patients with EML4-ALK expression. In this study, we have investigated the in vitro effects of Crizotinib in ALCL cell line with NPM-ALK fusion. Crizotinib induced marked downregulation of STAT3 phosp","Apoptosis/*drug effects, Cell Proliferation/drug effects, Crizotinib, Down-Regulation/drug effects, Humans, Lymphoma, Large-Cell, Anaplastic/genetics/*metabolism, Phosphorylation, Protein Kinase Inhibitors/*pharmacology, Protein-Tyrosine Kinases/genetics/metabolism, Proto-Oncogene Pr","Hamedani FS, Cinar M, Mo Z, Cervania MA, Amin HM, Alkan S","Leuk Res. 2014 Apr;38(4):503-8. doi","2014 Apr","S0145-2126(14)00003-4 [pii], 10.1016/j.leukres.2013.12.027 [doi]","Leukemia research"
"286","23124138","The tyrosine phosphatase TC48 interacts with and inactivates the onc","The chimeric oncoprotein BCR-Abl exhibits deregulated protein tyrosine kinase activity and is responsible for the pathogenesis of certain human leukemias, such as chronic myelogenous leukemia. The activities of cellular Abl (c-Abl) and BCR-Abl are stringently regulated and the cellular mechanisms involved in their inactivation are poorly understood. Protein tyrosine phosphatases can negatively regulate Abl mediated signaling by dephosphorylating the kinase and/or its substrates. This study investigated the ability of the intracellular T cell protein tyrosine phosphatase (TCPTP/PTPN2) to dephosphorylate and regulate the functions of BCR-Abl and c-Abl. TCPTP is expressed as two alternately spliced isoforms - TC48 and TC45, which differ in their C-termini and localize to the cytoplasm and nucleus respectively. We show that TC48 dephosphorylates BCR-Abl but not c-Abl and inhibits its activity towar","Fusion Proteins, bcr-abl/genetics/*metabolism, Humans, K562 Cells, Phosphorylation, Protein Binding, Protein Tyrosine Phosphatase, Non-Receptor Type 2/genetics/*metabolism, Proto-Oncogene Proteins c-abl/genetics/*metabolism, Proto-Oncogene Proteins c-bcr/genetics/metabolism","Mitra A, Sasikumar K, Parthasaradhi BV, Radha V","Biochim Biophys Acta. 2013 Jan;1832(1):275-84. doi","2013 Jan","S0925-4439(12)00251-7 [pii], 10.1016/j.bbadis.2012.10.014 [doi]","Biochimica et biophysica acta"
"287","26631023","Initial diagnosis of chronic myelogenous leukemia based on quantific","Formed from a reciprocal translocation t(9:22)(q34;q11) of genetic material between the long arms of human chromosomes 9 and 22, the constitutively active breakpoint cluster region (BCR) Abelson 1 (ABL) tyrosine kinase BCR-ABL is known to be causative of chronic myelogenous leukemia (CML). In 98% of CML patients harboring the t(9:22)(q34;q11) translocation, known as the Philadelphia chromosome, the chimeric BCR-ABL oncogene is created through cleavage of the BCR gene within its major breakpoint region (M-BCR) and breakage of the ABL gene within a 100-kbp region downstream of exon 2a. Clinical detection of the fused BCR-ABL oncogene currently relies on direct visualization by fluorescence in situ hybridization (FISH), a relatively tedious assay that typically offers a detection limit of ca. 2%. Here, we describe a novel assay that uses droplet digital PCR (ddPCR) technology to reliably measure M","Algorithms, Cell Line, Tumor, *Chromosome Breakpoints, Chromosomes, Human, Pair 9, Fusion Proteins, bcr-abl/genetics, Humans, In Situ Hybridization, Fluorescence/methods, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*diagnosis/*genetics, Limit of Detection, Models, St","Lund HL, Hughesman CB, McNeil K, Clemens S, Hocken K, Pettersson R, Karsan A, Foster LJ, Haynes C","Anal Bioanal Chem. 2016 Feb;408(4):1079-94. doi","2016 Feb","10.1007/s00216-015-9204-2 [doi], 10.1007/s00216-015-9204-2 [pii]","Analytical and bioanalytical chemistry"
"288","27965460","Opposing roles of KIT and ABL1 in the therapeutic response of gastro","Most gastrointestinal stromal tumors (GISTs) are caused by activating mutations of the KIT receptor tyrosine kinase. The small molecule inhibitor imatinib mesylate was initially developed to target the ABL1 kinase, which is constitutively activated through chromosomal translocation in BCR-ABL1-positive chronic myeloid leukemia. Because of cross-reactivity of imatinib against the KIT kinase, the drug is also successfully used for the treatment of GIST. Although inhibition of KIT clearly has a major role in the therapeutic response of GIST to imatinib, the contribution of concomitant inhibition of ABL in this context has never been explored. We show here that ABL1 is expressed in the majority of GISTs, including human GIST cell lines. Using siRNA-mediated knockdown, we demonstrate that depletion of KIT in conjunction with ABL1 - hence mimicking imatinib treatment - leads to reduced apoptosis indu","Adult, Aged, Aged, 80 and over, Cell Line, Tumor, Cell Proliferation/drug effects, Cell Survival/drug effects, Female, Gastrointestinal Neoplasms/drug therapy/*metabolism, Gastrointestinal Stromal Tumors/drug therapy/*metabolism, Gene Expression Regulation, Neoplastic, Humans, Imatin","Rausch JL, Boichuk S, Ali AA, Patil SS, Liu L, Lee DM, Brown MF, Makielski KR, Liu Y, Taguchi T, Kuan SF, Duensing A","Oncotarget. 2017 Jan 17;8(3):4471-4483. doi","2017 Jan","13882 [pii], 10.18632/oncotarget.13882 [doi]","Oncotarget"
"289","27472284","Viral/Nonviral Chimeric Nanoparticles To Synergistically Suppress Le","Single modal cancer therapy that targets one pathological pathway often turns out to be inefficient. For example, relapse of chronic myelogenous leukemia (CML) after inhibiting BCR-ABL fusion protein using tyrosine kinase inhibitors (TKI) (e.g., Imatinib) is of significant clinical concern. This study developed a dual modal gene therapy that simultaneously tackles two key BCR-ABL-linked pathways using viral/nonviral chimeric nanoparticles (ChNPs). Consisting of an adeno-associated virus (AAV) core and an acid-degradable polymeric shell, the ChNPs were designed to simultaneously induce pro-apoptotic BIM expression by the AAV core and silence pro-survival MCL-1 by the small interfering RNA (siRNA) encapsulated in the shell. The resulting BIM/MCL-1 ChNPs were able to efficiently suppress the proliferation of BCR-ABL+ K562 and FL5.12/p190 cells in vitro and in vivo via simultaneously expressing BIM","Antineoplastic Agents/*pharmacology, Apoptosis, Benzamides, Cell Proliferation, Drug Resistance, Neoplasm, Fusion Proteins, bcr-abl, *Gene Silencing, Genetic Therapy, Humans, K562 Cells, Leukemia/*drug therapy, *Nanoparticles, Piperazines, Protein Kinase Inhibitors, Pyrimidines, *Tra","Hong CA, Cho SK, Edson JA, Kim J, Ingato D, Pham B, Chuang A, Fruman DA, Kwon YJ","ACS Nano. 2016 Sep 27;10(9):8705-14. doi","2016 Sep","10.1021/acsnano.6b04155 [doi]","ACS nano"
"290","25349176","A novel recurrent NPM1-TYK2 gene fusion in cutaneous CD30-positive l","The spectrum of cutaneous CD30-positive lymphoproliferative disorders (LPDs) includes lymphomatoid papulosis and primary cutaneous anaplastic large cell lymphoma. Chromosomal translocations targeting tyrosine kinases in CD30-positive LPDs have not been described. Using whole-transcriptome sequencing, we identified a chimeric fusion involving NPM1 (5q35) and TYK2 (19p13) that encodes an NPM1-TYK2 protein containing the oligomerization domain of NPM1 and an intact catalytic domain in TYK2. Fluorescence in situ hybridization revealed NPM1-TYK2 fusions in 2 of 47 (4%) primary cases of CD30-positive LPDs and was absent in other mature T-cell neoplasms (n = 151). Functionally, NPM1-TYK2 induced constitutive TYK2, signal transducer and activator of transcription 1 (STAT1), STAT3, and STAT5 activation. Conversely, a kinase-defective NPM1-TYK2 mutant abrogated STAT1/3/5 signaling. Finally, short hairpin","Blotting, Western, Cell Line, Tumor, Gene Expression Regulation, Neoplastic, HEK293 Cells, Humans, In Situ Hybridization, Fluorescence, Ki-1 Antigen/*genetics/metabolism, Lymphoma, Primary Cutaneous Anaplastic Large Cell/*genetics/metabolism/pathology, Lymphomatoid Papulosis/*genetic","Velusamy T, Kiel MJ, Sahasrabuddhe AA, Rolland D, Dixon CA, Bailey NG, Betz BL, Brown NA, Hristov AC, Wilcox RA, Miranda RN, Medeiros LJ, Jeon YK, Inamdar KV, Lim MS, Elenitoba-Johnson KS","Blood. 2014 Dec 11;124(25):3768-71. doi","2014 Dec","blood-2014-07-588434 [pii], 10.1182/blood-2014-07-588434 [doi]","Blood"
"291","25697481","Restoration of miR-424 suppresses BCR-ABL activity and sensitizes CM","MicroRNAs (miRNAs) are small noncoding RNAs that participate in many biological processes by posttranscriptionally regulating gene expression. Dysregulation of miRNA expression has been shown to be typical of many neoplasms. Chronic myeloid leukemia (CML) is a disorder of hematopoietic stem cells carrying the Philadelphia (Ph) chromosome and an oncogenic BCR-ABL tyrosine kinase fusion gene. While the development of tyrosine kinase inhibitors (TKIs) like imatinib has revolutionized treatment of CML, it has become increasingly clear in recent years that TKI treatment alone will not be curative in many cases. Thus, further dissection of the regulatory networks that drive BCR-ABL-induced malignant transformation may help to identify other novel therapeutic approaches that complement TKI treatment. In this study we demonstrate that the expression of miR-424 is markedly low in CML cell lines and pati","Antineoplastic Agents/pharmacology, Apoptosis/drug effects/genetics, Base Sequence, Benzamides/*pharmacology, Cell Growth Processes/drug effects/genetics, Combined Modality Therapy, Down-Regulation, Fusion Proteins, bcr-abl/*antagonists & inhibitors/biosynthesis/genetics/metabolism, ","Hershkovitz-Rokah O, Modai S, Pasmanik-Chor M, Toren A, Shomron N, Raanani P, Shpilberg O, Granot G","Cancer Lett. 2015 May 1;360(2):245-56. doi","2015 May","S0304-3835(15)00135-4 [pii], 10.1016/j.canlet.2015.02.031 [doi]","Cancer letters"
"292","29360440","A novel in-cell ELISA method for screening of compounds inhibiting T","Tropomyosin-related kinase A (TRKA) fusion was originally detected in colorectal carcinoma that had resulted in expression of the oncogenic chimeric protein TPM3-TRKA. Lately, many more rearrangements in TRK family of kinases generating oncogenic fusion proteins have been identified. These genetic rearrangements usually result in fusion of cytoplasmic kinase domain of TRK to another gene of interest resulting in constitutive kinase activity. Estimation of TRK inhibitor potency in a cellular context is required for drug discovery programs and is measured by receptor phosphorylation levels upon compound administration. However, since a large chunk of the TRK protein is lost in this rearrangement, it's difficult to set up sandwich ELISA for detection of receptor phosphorylation in any cell assay harboring these fusion proteins. In order to address this issue, we developed a novel and robust in-cel","Animals, Cell Line, Cell Proliferation/drug effects, Dose-Response Relationship, Drug, Drug Evaluation, Preclinical, Enzyme-Linked Immunosorbent Assay/*methods, Humans, Mice, Phosphorylation/drug effects, Protein Kinase Inhibitors/chemistry/*pharmacology, Receptor, trkA/*antagonists ","Pandre MK, Shaik S, Satya Pratap VVV, Yadlapalli P, Yanamandra M, Mitra S","Anal Biochem. 2018 Mar 15;545:78-83. doi","2018 Mar","S0003-2697(18)30023-X [pii], 10.1016/j.ab.2018.01.014 [doi]","Analytical biochemistry"
"293","22782217","TAT-CC fusion protein depresses the oncogenicity of BCR-ABL in vitro","Chronic myeloid leukemia (CML) is a clonal hematologic malignancy characterized by the BCR-ABL protein. BCR-ABL is a constitutively active tyrosine kinase and plays a critical role in the pathogenesis of CML. Imatinib mesylate, a selective tyrosine kinase inhibitor, is effective in CML, but drug resistance and relapse occur. The coiled-coil (CC) domain located in BCR(1-72) mediates BCR-ABL tetramerization, which is essential for the activation of tyrosine kinase and transformation potential of BCR-ABL. CC domain is supposed to be a therapeutic target for CML. We purified a TAT-CC protein competively binding with the endogenous CC domain to reduce BCR-ABL kinase activity. We found that TAT-CC co-located and interacted with BCR-ABL in Ba/F3-p210 and K562 cells. It induced apoptosis and inhibited proliferation in these cells. It increased the sensitivity of these cells to imatinib and reduced the ","Animals, Apoptosis, Cell Line, Tumor, Cell Proliferation, Fusion Proteins, bcr-abl/*chemistry/genetics/*metabolism, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*enzymology/genetics/physiopathology, Mice, Peptides/genetics/*metabolism, Protein Binding, Protein Structure, ","Huang ZL, Gao M, Ji MS, Tao K, Xiao Q, Zhong L, Zeng JM, Feng WL","Amino Acids. 2013 Feb;44(2):461-72. doi","2013 Feb","10.1007/s00726-012-1354-3 [doi]","Amino acids"
"294","30242093","Selective TRK Inhibitor CH7057288 against TRK Fusion-Driven Cancer.","Members of the tropomyosin receptor kinase (TRK) family are expressed in their constitutively activated forms as a result of a gene fusion that occurs across a wide variety of cancer types. We have identified CH7057288 as a potent and selective TRK inhibitor that belongs to a novel chemical class. CH7057288 showed selective inhibitory activity against TRKA, TRKB, and TRKC in cell-free kinase assays and suppressed proliferation of TRK fusion-positive cell lines, but not that of TRK-negative cell lines. Strong in vivo tumor growth inhibition was observed in subcutaneously implanted xenograft tumor models of TRK fusion-positive cells. Furthermore, in an intracranial implantation model mimicking brain metastasis, CH7057288 significantly induced tumor regression and improved event-free survival. Recently, resistant mutations in the kinase domain of TRK have been reported in patients who show disease","Animals, Benzofurans/*pharmacology, Cell Line, Tumor, Drug Resistance, Neoplasm/drug effects, Female, Humans, Mice, Inbred BALB C, Mice, Nude, Mutation/genetics, Neoplasms/*pathology, Oncogene Proteins, Fusion/*metabolism, Protein Kinase Inhibitors/*pharmacology, Protein Kinases/chem","Tanaka H, Sase H, Tsukaguchi T, Hasegawa M, Tanimura H, Yoshida M, Sakata K, Fujii T, Tachibana Y, Takanashi K, Higashida A, Hasegawa K, Ono Y, Oikawa N, Mio T","Mol Cancer Ther. 2018 Dec;17(12):2519-2529. doi","2018 Dec","1535-7163.MCT-17-1180 [pii], 10.1158/1535-7163.MCT-17-1180 [doi]","Molecular cancer therapeutics"
"295","30784762","Pak1 gene functioned differentially in different BCR-ABL subtypes in","The BCR-ABL fusion gene (BCR-ABL) has different subtypes such as p210 and p190 with p190 appear to lead to a worse prognosis. To explore the mechanism of difference in pathogenesis and prognosis in different BCR-ABL subtype-related leukemia, expression profile microarray analysis was conducted between p190 and p210 patients and verified by RT-PCR. The p21-activated kinase (PAK1) gene was chosen and regulation of the PAK1-STAT5 biological axis and its influence on proliferation and apoptosis in leukemia cells were also analyzed. The results showed that PAK1 might be an important molecular mechanism of the pathogenic difference between different BCR-ABL subtypes. In P210 (+) chronic myelogenous leukemia (CML), down-regulated PAK1 gene expressions may lead to the suppression of cell proliferation and promotion of apoptosis through phosphorylation of STAT5, with a reverse effect in P190 (+) acute l","Cell Transformation, Neoplastic/*genetics, Fusion Proteins, bcr-abl/classification/*genetics, Gene Expression Profiling, Gene Expression Regulation, Leukemic, HEK293 Cells, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics/metabolism/therapy, Microarray An","Yuanxin Y, Yanhong Z, Qin Z, Sishi T, Yang D, Yi Z, Minjin W, Juan Z, Xiaojun L, Lanlan W, Binwu Y","Leuk Res. 2019 Apr;79:6-16. doi","2019 Apr","S0145-2126(19)30018-9 [pii], 10.1016/j.leukres.2019.01.012 [doi]","Leukemia research"
"296","24747551","A calpain-cleaved fragment of beta-catenin promotes BCRABL1+ cell su","Autophagy protects chronic myeloid leukemia stem cells from tyrosine kinase inhibitors hence supporting the disease persistence under therapy. However, the signals involved in autophagy regulation relative to BCR-ABL1 are still elusive. The autophagic flux proceeding from the inhibition of BCR-ABL1 tyrosine kinase represents a regulatory mechanism of beta-catenin stability through events encompassing the activation of calpain, which targets beta-catenin for proteasome-independent degradation. Accordingly, its inactivation may contribute to induce autophagy and autophagy induction may, in turn, promote beta-catenin autolysosomal degradation to originate a regulatory loop where beta-catenin plays a central role in cell decision between life and death. Here we proved that the cytoplasmic accumulation of beta-catenin driven by up-regulation of its antagonist Chibby1 is a component of autophagy indu","Antineoplastic Agents/*pharmacology, Autophagy/*drug effects, Benzamides/*pharmacology, Calcium/metabolism, Calpain/*metabolism, Carrier Proteins/antagonists & inhibitors/metabolism, Cell Line, Tumor, Cell Survival/drug effects, Endoplasmic Reticulum Stress, Fusion Proteins, bcr-abl/","Mancini M, Leo E, Campi V, Castagnetti F, Zazzeroni L, Gugliotta G, Santucci MA, Martinelli G","Cell Signal. 2014 Aug;26(8):1690-7. doi","2014 Aug","S0898-6568(14)00145-4 [pii], 10.1016/j.cellsig.2014.04.010 [doi]","Cellular signalling"
"297","23128391","Novel BRD4-NUT fusion isoforms increase the pathogenic complexity in","Nuclear protein in testis (NUT)-midline carcinoma (NMC) is a rare, aggressive disease typically presenting with a single t(15;19) translocation that results in the generation of a bromodomain-containing protein 4 (BRD4)-NUT fusion. PER-624 is a cell line generated from an NMC patient with an unusually complex karyotype that gave no initial indication of the involvement of the NUT locus. Analysis of PER-624 next-generation transcriptome sequencing (RNA-Seq) using the algorithm FusionFinder identified a novel transcript in which Exon 15 of BRD4 was fused to Exon 2 of NUT, therefore differing from all published NMC fusion transcripts. The three additional exons contained in the PER-624 fusion encode a series of polyproline repeats, with one predicted to form a helix. In the NMC cell line PER-403, we identified the 'standard' NMC fusion and two novel isoforms. Knockdown by small interfering RNA in ","Adolescent, Antineoplastic Combined Chemotherapy Protocols/therapeutic use, Base Sequence, Carcinoma/drug therapy/*genetics/pathology, Cell Differentiation, Cell Line, Tumor/metabolism/ultrastructure, Cell Size, Child, Chromosomes, Human, Pair 15/*genetics/ultrastructure, Chromosomes","Thompson-Wicking K, Francis RW, Stirnweiss A, Ferrari E, Welch MD, Baker E, Murch AR, Gout AM, Carter KW, Charles AK, Phillips MB, Kees UR, Beesley AH","Oncogene. 2013 Sep 26;32(39):4664-74. doi","2013 Sep","onc2012487 [pii], 10.1038/onc.2012.487 [doi]","Oncogene"
"298","24021598","Enrichment and enumeration of circulating tumor cells by efficient d","BACKGROUND: Enumeration and characterization of circulating tumor cells (CTCs) can provide information on patient prognosis and treatment efficacy. However, CTCs are rare, making their isolation a major technological challenge. We developed a technique for enrichment, and subsequent characterization of CTCs based on efficient depletion of human leukocytes. METHODS: The technique (CanPatrolTM CTC enrichment) we developed is based on red blood cell lysis to remove erythrocytes, followed by depletion of CD45+ leukocytes using a magnetic bead separation method, and subsequent isolation of CTCs by virtue of their larger size, compared with leukocytes. We also demonstrated that fluorescence in situ hybridization (FISH) and genetic abnormalities analysis could be performed on the isolated CTCs. RESULTS: The spiking experiments showed that the average efficacy of leukocytes depletion was 99.98% and the","Anaplastic Lymphoma Kinase, Cell Line, Tumor, Cell Size, DNA/analysis, DNA Mutational Analysis, ErbB Receptors/genetics/metabolism, Erythrocytes/cytology/metabolism, Female, Hemolysis, Hep G2 Cells, Humans, *Immunomagnetic Separation, Leukocyte Common Antigens/immunology/metabolism, ","Wu S, Liu Z, Liu S, Lin L, Yang W, Xu J","Clin Chem Lab Med. 2014 Feb;52(2):243-51. doi","2014 Feb","10.1515/cclm-2013-0558 [doi], /j/cclm.ahead-of-print/cclm-2013-0558/cclm-2013-0558.xml [pii]","Clinical chemistry and laboratory medicine"
"299","29913272","siRNA/lipopolymer nanoparticles to arrest growth of chronic myeloid ","Therapies for the treatment of Chronic Myeloid Leukemia and other leukemias are still limited for patients at advanced stages, which allow development of point mutations in the BCR-ABL fusion gene that render CML cells insensitive to therapies. An effective non-viral delivery system based on lipopolymers is described in this study to deliver specific siRNAs to CML cells for therapeutic gene silencing. The lipopolymer, based on the lipid alpha-linolenic acid (alphaLA) substitution on low molecular weight polyethyleneimine (PEI), was used to deliver siRNA against the BCR-ABL gene and, the resultant therapeutic effect was evaluated in in vitro and in vivo CML models. The study concluded that siRNA/PEI-alphaLA nanoparticles enabled silencing of the BCR-ABL gene and BCR-ABL protein, which consequently reduced growth on CML K562 cells in vitro and arrested the growth of localized tumors in a localize","Animals, Fusion Proteins, bcr-abl/*genetics, Gene Silencing, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/therapy, Mice, Mice, Nude, *Nanoparticles, Point Mutation, Polyethyleneimine/chemistry, Polymers/chemistry, RNA Interference, RNA, Small Interfe","Valencia-Serna J, Aliabadi HM, Manfrin A, Mohseni M, Jiang X, Uludag H","Eur J Pharm Biopharm. 2018 Sep;130:66-70. doi","2018 Sep","S0939-6411(18)30511-3 [pii], 10.1016/j.ejpb.2018.06.018 [doi]","European journal of pharmaceutics and biopharmaceutics"
"300","29119387","A new ETV6-NTRK3 cell line model reveals MALAT1 as a novel therapeut","BACKGROUND: Previously, the chromosomal translocation t(12;15)(p13;q25) has been found to recurrently occur in both solid tumors and leukemias. This translocation leads to ETV6-NTRK3 (EN) gene fusions resulting in ectopic expression of the NTRK3 neurotropic tyrosine receptor kinase moiety as well as oligomerization through the donated ETV6-sterile alpha motif domain. As yet, no in vitro cell line model carrying this anomaly is available. Here we genetically characterized the acute promyelocytic leukemia (APL) cell line AP-1060 and, by doing so, revealed the presence of a t(12;15)(p13;q25). Subsequently, we evaluated its suitability as a model for this important clinical entity. METHODS: Spectral karyotyping, fluorescence in situ hybridization (FISH), and genomic and transcriptomic microarray-based profiling were used to screen for the presence of EN fusions. qRT-PCR was used for quantitative ex","Antineoplastic Agents/pharmacology/therapeutic use, Arsenic Trioxide, Arsenicals/pharmacology/therapeutic use, Cell Line, Cell Proliferation/drug effects, Humans, Leukemia, Promyelocytic, Acute/drug therapy/*genetics/metabolism/pathology, Mitogen-Activated Protein Kinase 1/metabolism","Chen S, Nagel S, Schneider B, Dai H, Geffers R, Kaufmann M, Meyer C, Pommerenke C, Thress KS, Li J, Quentmeier H, Drexler HG, MacLeod RAF","Cell Oncol (Dordr). 2018 Feb;41(1):93-101. doi","2018 Feb","10.1007/s13402-017-0356-2 [doi], 10.1007/s13402-017-0356-2 [pii]","Cellular oncology (Dordrecht)"
"301","26001971","Chromosomal rearrangements involving the NTRK1 gene in colorectal ca","Chromosomal rearrangements of the NTRK1 gene, which encodes the high affinity nerve growth factor receptor (tropomyosin related kinase, TRKA), have been observed in several epithelial cancers, such as colon cancer, papillary thyroid carcinoma or non small cell lung cancer. The various NTRK1 fusions described so far lead to constitutive activation of TRKA kinase activity and are oncogenic. We further investigated here the existence and the frequency of NTRK1 gene rearrangements in colorectal cancer. Using immunohistochemistry and quantitative reverse transcriptase PCR, we analyzed a series of human colorectal cancers. We identified two TRKA positive cases over 408, with NTRK1 chromosomal rearrangements. One of these rearrangements is a TPM3-NTRK1 fusion already observed in colon cancer, while the second one is a TPR-NTRK1 fusion never described in this type of cancer. These findings further conf","Animals, Base Sequence, Biomarkers, Tumor/analysis/*genetics, Carcinoma/chemistry/*genetics/pathology, Cell Line, Tumor, Colorectal Neoplasms/chemistry/*genetics/pathology, Gene Fusion, *Gene Rearrangement, Humans, Immunohistochemistry, Mice, Nude, Molecular Sequence Data, Nuclear Po","Creancier L, Vandenberghe I, Gomes B, Dejean C, Blanchet JC, Meilleroux J, Guimbaud R, Selves J, Kruczynski A","Cancer Lett. 2015 Aug 28;365(1):107-11. doi","2015 Aug","S0304-3835(15)00341-9 [pii], 10.1016/j.canlet.2015.05.013 [doi]","Cancer letters"
"302","30131584","Dependency on the TYK2/STAT1/MCL1 axis in anaplastic large cell lymp","TYK2 is a member of the JAK family of tyrosine kinases that is involved in chromosomal translocation-induced fusion proteins found in anaplastic large cell lymphomas (ALCL) that lack rearrangements activating the anaplastic lymphoma kinase (ALK). Here we demonstrate that TYK2 is highly expressed in all cases of human ALCL, and that in a mouse model of NPM-ALK-induced lymphoma, genetic disruption of Tyk2 delays the onset of tumors and prolongs survival of the mice. Lymphomas in this model lacking Tyk2 have reduced STAT1 and STAT3 phosphorylation and reduced expression of Mcl1, a pro-survival member of the BCL2 family. These findings in mice are mirrored in human ALCL cell lines, in which TYK2 is activated by autocrine production of IL-10 and IL-22 and by interaction with specific receptors expressed by the cells. Activated TYK2 leads to STAT1 and STAT3 phosphorylation, activated expression of MC","Anaplastic Lymphoma Kinase/genetics, Animals, Apoptosis/drug effects/genetics, Cell Line, Tumor, Cell Survival/drug effects/genetics, Gene Expression Regulation, Neoplastic/drug effects/genetics, Humans, Lymphoma, Large-Cell, Anaplastic/drug therapy/*genetics, Mice, Myeloid Cell Leuk","Prutsch N, Gurnhofer E, Suske T, Liang HC, Schlederer M, Roos S, Wu LC, Simonitsch-Klupp I, Alvarez-Hernandez A, Kornauth C, Leone DA, Svinka J, Eferl R, Limberger T, Aufinger A, Shirsath N, Wolf P, Hielscher T, Aberger F, Schmoellerl J, Stoiber D, Strobl B, Jager U, Staber PB, Grebien F, Moriggl R, Muller","Leukemia. 2019 Mar;33(3):696-709. doi","2019 Mar","10.1038/s41375-018-0239-1 [doi], 10.1038/s41375-018-0239-1 [pii]","Leukemia"
"303","29691899","Droplet digital PCR for BCR/ABL(P210) detection of chronic myeloid l","OBJECTIVE: This study intended to establish a droplet digital PCR (dd-PCR) for monitoring minimal residual disease (MRD) in patients with BCR/ABL (P210)-positive chronic myeloid leukemia (CML), thereby achieving deep-level monitoring of tumor load and determining the efficacy for guided clinically individualized treatment. METHODS: Using dd-PCR and RT-qPCR, two cell suspensions were obtained from K562 cells and normal peripheral blood mononuclear cells by gradient dilution and were measured at the cellular level. At peripheral blood (PB) level, 61 cases with CML-chronic phase (CML-CP) were obtained after tyrosine kinase inhibitor (TKI) treatment and regular follow-ups. By RT-qPCR, BCR/ABL (P210) fusion gene was undetectable in PB after three successive analyses, which were performed once every 3 months. At the same time, dd-PCR was performed simultaneously with the last equal amount of cDNA. Te","Adolescent, Adult, Aged, Aged, 80 and over, Disease Progression, Female, Fusion Proteins, bcr-abl/*genetics, Gene Expression Regulation, Leukemic, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*diagnosis/*genetics, Male, Middle Aged, Neoplasm, Residual/*diagnos","Wang WJ, Zheng CF, Liu Z, Tan YH, Chen XH, Zhao BL, Li GX, Xu ZF, Ren FG, Zhang YF, Chang JM, Wang HW","Eur J Haematol. 2018 Sep;101(3):291-296. doi","2018 Sep","10.1111/ejh.13084 [doi]","European journal of haematology"
"304","25054037","Investigation of neurotrophic tyrosine kinase receptor 1 fusions and","Advances in the molecular segmentation of lung cancer has raised the possibility that neurotrophic tyrosine kinase receptor (NTRK) 1 fusions and NTRK1-3 expression may be promising molecular targets for future therapeutic interventions. We investigated the antitumor effects of a selective pan-NTRK inhibitor, AZD7451, by evaluating its antiproliferative effects on the KM12 cell line (a colorectal cancer cell line harboring a tropomyosin-NTRK1 fusion) and the H460 and H810 cell lines [large-cell neuroendocrine carcinoma (LCNEC) cell lines expressing NTRK2]. Relative quantitative polymerase chain reaction (qPCR) was performed to measure the mRNA levels of the NTRK1-3 tyrosine kinase domain using cDNA extracted from KM12, H460 and H810 cells. The cultures were grown in 6-well plates at a density of 1.0x10(6) cell/well and treated with AZD7451 at different doses (1, 2.5, 4, 5, 7.5 and 10 nM) using d","?","Tatematsu T, Sasaki H, Shimizu S, Okuda K, Shitara M, Hikosaka Y, Moriyama S, Yano M, Brown J, Fujii Y","Mol Clin Oncol. 2014 Sep;2(5):725-730. doi","2014 Sep","10.3892/mco.2014.318 [doi], mco-02-05-0725 [pii]","Molecular and clinical oncology"
"305","27627808","Preclinical Activity of ARQ 087, a Novel Inhibitor Targeting FGFR Dy","Dysregulation of Fibroblast Growth Factor Receptor (FGFR) signaling through amplifications, mutations, and gene fusions has been implicated in a broad array of cancers (e.g. liver, gastric, ovarian, endometrial, and bladder). ARQ 087 is a novel, ATP competitive, small molecule, multi-kinase inhibitor with potent in vitro and in vivo activity against FGFR addicted cell lines and tumors. Biochemically, ARQ 087 exhibited IC50 values of 1.8 nM for FGFR2, and 4.5 nM for FGFR1 and 3. In cells, inhibition of FGFR2 auto-phosphorylation and other proteins downstream in the FGFR pathway (FRS2alpha, AKT, ERK) was evident by the response to ARQ 087 treatment. Cell proliferation studies demonstrated ARQ 087 has anti-proliferative activity in cell lines driven by FGFR dysregulation, including amplifications, fusions, and mutations. Cell cycle studies in cell lines with high levels of FGFR2 protein showed a p","Aniline Compounds/*pharmacology, Animals, Antineoplastic Agents/pharmacology, Blotting, Western, COS Cells/drug effects/physiology, Cell Cycle/drug effects, Cell Line, Cell Proliferation/drug effects, Chlorocebus aethiops, Female, Mice, Nude, Mice, SCID, Neoplasm Transplantation, Neo","Hall TG, Yu Y, Eathiraj S, Wang Y, Savage RE, Lapierre JM, Schwartz B, Abbadessa G","PLoS One. 2016 Sep 14;11(9):e0162594. doi","2016","10.1371/journal.pone.0162594 [doi], PONE-D-15-53799 [pii]","PloS one"
"306","28345463","Computational and mechanistic studies on the effect of galactoxylogl","Imatinib mesylate, a BCR/ABL fusion protein inhibitor, is the first-line treatment against chronic myelogenous leukemia. In spite of its advantageous viewpoints, imatinib still has genuine impediments like undesirable side effects and tumor resistance during chemotherapy. Nanoparticles with sustainable release profile will help in targeted delivery of anticancer drugs while minimizing deleterious side effects and drug resistance. The use of biopolymers like galactoxyloglucan (PST001) for the fabrication of imatinib mesylate nanoparticles could impart its use in overcoming multidrug resistance in chronic myelogenous leukemia patients with minimal side effects. This study involved in the synthesis of PST-Imatinib nanoconjugates with appreciable drug payload and excellent cytotoxicity against drug-resistant chronic myelogenous leukemia cell line (K562) in comparison with free drug. The use of bioi","Antineoplastic Agents/*therapeutic use, Cell Line, Tumor, DNA Topoisomerases/genetics, Delayed-Action Preparations/*therapeutic use, Drug Resistance, Neoplasm/drug effects, ErbB Receptors/genetics, Glucans/*therapeutic use, Humans, Imatinib Mesylate/*therapeutic use, K562 Cells, Leuk","James AR, Unnikrishnan BS, Priya R, Joseph MM, Manojkumar TK, Raveendran Pillai K, Shiji R, Preethi GU, Kusumakumary P, Sreelekha TT","Tumour Biol. 2017 Mar;39(3):1010428317695946. doi","2017 Mar","10.1177/1010428317695946 [doi]","Tumour biology"
"307","28128329","Oridonin Triggers Chaperon-mediated Proteasomal Degradation of BCR-A","Inducing degradation of oncoproteins by small molecule compounds has the potential to avoid drug resistance and therefore deserves to be exploited for new therapies. Oridonin is a natural compound with promising antitumor efficacy that can trigger the degradation of oncoproteins; however, the direct cellular targets and underlying mechanisms remain unclear. Here we report that oridonin depletes BCR-ABL through chaperon-mediated proteasomal degradation in leukemia. Mechanistically, oridonin poses oxidative stress in cancer cells and directly binds to cysteines of HSF1, leading to the activation of this master regulator of the chaperone system. The resulting induction of HSP70 and ubiquitin proteins and the enhanced binding to CHIP E3 ligase hence target BCR-ABL for ubiquitin-proteasome degradation. Both wild-type and mutant forms of BCR-ABL can be efficiently degraded by oridonin, supporting its","Antineoplastic Agents/pharmacology, Apoptosis/drug effects, Base Sequence, Cell Line, Tumor, Cell Proliferation/drug effects, Cysteine/metabolism, Diterpenes, Kaurane/*pharmacology, Drug Resistance, Neoplasm/drug effects, Fusion Proteins, bcr-abl/*metabolism, Gene Deletion, HL-60 Cel","Huang H, Weng H, Dong B, Zhao P, Zhou H, Qu L","Sci Rep. 2017 Jan 27;7:41525. doi","2017 Jan","srep41525 [pii], 10.1038/srep41525 [doi]","Scientific reports"
"308","25919613","The functional interplay between the t(9;22)-associated fusion prote","The hallmark of Philadelphia chromosome positive (Ph(+)) leukemia is the BCR/ABL kinase, which is successfully targeted by selective ATP competitors. However, inhibition of BCR/ABL alone is unable to eradicate Ph(+) leukemia. The t(9;22) is a reciprocal translocation which encodes not only for the der22 (Philadelphia chromosome) related BCR/ABL, but also for der9 related ABL/BCR fusion proteins, which can be detected in 65% of patients with chronic myeloid leukemia (CML) and 100% of patients with Ph+ acute lymphatic leukemia (ALL). ABL/BCRs are oncogenes able to influence the lineage commitment of hematopoietic progenitors. Aim of this study was to further disclose the role of p96(ABL/BCR) for the pathogenesis of Ph(+) ALL. The co-expression of p96(ABL/BCR) enhanced the kinase activity and as a consequence, the transformation potential of p185(BCR/ABL). Targeting p96(ABL/BCR) by RNAi inhibited ","Cell Line, Tumor, Chromosomes, Human, Pair 22/genetics, Chromosomes, Human, Pair 9/genetics, Fusion Proteins, bcr-abl/biosynthesis/*genetics, Gene Expression Regulation, Leukemic, Hematopoietic Stem Cells/pathology, Humans, Philadelphia Chromosome, Precursor Cell Lymphoblastic Leukem","Rafiei A, Mian AA, Doring C, Metodieva A, Oancea C, Thalheimer FB, Hansmann ML, Ottmann OG, Ruthardt M","PLoS Genet. 2015 Apr 28;11(4):e1005144. doi","2015 Apr","10.1371/journal.pgen.1005144 [doi], PGENETICS-D-14-01474 [pii]","PLoS genetics"
"309","30943926","Expression of C-terminal ALK, RET, or ROS1 in lung cancer cells with","BACKGROUND: Genetic alterations, including mutation of epidermal growth factor receptor or v-Ki-ras2 kirsten rat sarcoma viral oncogene homolog and fusion of anaplastic lymphoma kinase (ALK), RET proto-oncogene (RET), or v-ros UR2 sarcoma virus oncogene homolog 1 (ROS1), occur in non-small cell lung cancers, and these oncogenic drivers are important biomarkers for targeted therapies. A useful technique to screen for these fusions is the detection of native carboxy-terminal (C-terminal) protein by immunohistochemistry; however, the effects of other genetic alterations on C-terminal expression is not fully understood. In this study, we evaluated whether C-terminal expression is specifically elevated by fusion with or without typical genetic alterations of lung cancer. METHODS: In 37 human lung cancer cell lines and four tissue specimens, protein and mRNA levels were measured by capillary western ","Anaplastic Lymphoma Kinase/chemistry/*genetics/metabolism, Biomarkers, Tumor/genetics, Cell Line, Tumor, Gene Expression Profiling/methods, Gene Expression Regulation, Neoplastic, Humans, Lung Neoplasms/*genetics/metabolism, Oncogene Proteins, Fusion/genetics, Protein-Tyrosine Kinase","Furugaki K, Mochizuki M, Kohno M, Shu S, Harada N, Yoshimura Y","BMC Cancer. 2019 Apr 3;19(1):301. doi","2019 Apr","10.1186/s12885-019-5527-2 [doi], 10.1186/s12885-019-5527-2 [pii]","BMC cancer"
"310","26874514","Use of deferasirox, an iron chelator, to overcome imatinib resistanc","BACKGROUND/AIMS: The treatment of chronic myeloid leukemia (CML) has achieved impressive success since the development of the Bcr-Abl tyrosine kinase inhibitor, imatinib mesylate. Nevertheless, resistance to imatinib has been observed, and a substantial number of patients need alternative treatment strategies. METHODS: We have evaluated the effects of deferasirox, an orally active iron chelator, and imatinib on K562 and KU812 human CML cell lines. Imatinib-resistant CML cell lines were created by exposing cells to gradually increasing concentrations of imatinib. RESULTS: Co-treatment of cells with deferasirox and imatinib induced a synergistic dose-dependent inhibition of proliferation of both CML cell lines. Cell cycle analysis showed an accumulation of cells in the subG1 phase. Western blot analysis of apoptotic proteins showed that co-treatment with deferasirox and imatinib induced an increa","Antineoplastic Agents/*pharmacology, Apoptosis/drug effects, Apoptosis Regulatory Proteins/metabolism, Benzoates/*pharmacology, Cell Proliferation/drug effects, Deferasirox, Dose-Response Relationship, Drug, Drug Resistance, Neoplasm/*drug effects, G1 Phase Cell Cycle Checkpoints/dru","Kim DS, Na YJ, Kang MH, Yoon SY, Choi CW","Korean J Intern Med. 2016 Mar;31(2):357-66. doi","2016 Mar","10.3904/kjim.2015.024 [doi], kjim.2015.024 [pii]","The Korean journal of internal medicine"
"311","9266939","Establishment of a novel human myeloid leukaemia cell line (HNT-34) ","A novel human myeloid leukaemia cell line (HNT-34) was established from the peripheral blood of a 45-year-old female patient with acute myelogenous leukaemia (AML) transformed from chronic myelomonocytic leukaemia (CMMoL) with 3q21q26 syndrome. Morphologically, the HNT-34 cells were undifferentiated blasts which were negative for myeloperoxidase. The HNT-34 cells were positive for CD4, CD13, CD33 and CD34, but negative for CD41a and CD42b. The cells actively proliferated in suspension with a doubling time of 26-27h in the absence of any growth factors. Neither proliferative advantage nor differentiation was observed with the addition of G-CSE GM-CSF, IL-3, TPO, DMSO or PMA. Cytogenetic analysis showed 46,XX. t(3;3)(q21;q26), t(9;22)(q34;q11),20q-. Molecular analysis showed expression of EVI1 gene, P210 and P190 BCR/ABL chimaeric transcripts. The chromosomal breakpoint at 3q26 of HNT-34 cell lin","Antigens, Surface/analysis, Blotting, Northern, Cell Transformation, Neoplastic, Chimera, Chromosomes, Human, Pair 22/*genetics, Chromosomes, Human, Pair 3/*genetics, Chromosomes, Human, Pair 9/*genetics, Fatal Outcome, Female, Fusion Proteins, bcr-abl/genetics, Humans, Karyotyping, ","Hamaguchi H, Suzukawa K, Nagata K, Yamamoto K, Yagasaki F, Morishita K","Br J Haematol. 1997 Aug;98(2):399-407. doi","1997 Aug","10.1046/j.1365-2141.1997.2143029.x [doi]","British journal of haematology"
"312","29627725","Proteolysis Targeting Chimeras (PROTACs) of Anaplastic Lymphoma Kina","Anaplastic lymphoma kinase (ALK) activation has been associated with many types of human cancer. Significant efforts have been devoted to the development of ALK inhibitors to antagonize the kinase activity of ALK. Four ALK inhibitors have been approved by the FDA to date for treating patients with ALK-positive non-small cell lung cancers (NSCLC). However, drug resistance has been observed in the majority of patients treated with these inhibitors. New therapeutic strategies (e.g., compounds with novel mechanisms of action) are needed to overcome the drug resistance issue. The emerging PROTAC (Proteolysis Targeting Chimera) technology has been successfully applied to selective degradation of multiple protein targets, but not ALK. Since ALK protein levels are not important for viability in mammals, ALK PROTACs could lead to novel therapeutics with minimal toxicity. Here we report the design, synth","Anaplastic Lymphoma Kinase, Animals, Antineoplastic Agents/chemistry/pharmacokinetics/pharmacology, Cell Line, Tumor, Cell Proliferation/drug effects, Drug Design, Humans, Lung Neoplasms/drug therapy/metabolism, Lymphoma/drug therapy/metabolism, Male, Mice, Protein Kinase Inhibitors/","Zhang C, Han XR, Yang X, Jiang B, Liu J, Xiong Y, Jin J","Eur J Med Chem. 2018 May 10;151:304-314. doi","2018 May","S0223-5234(18)30314-3 [pii], 10.1016/j.ejmech.2018.03.071 [doi]","European journal of medicinal chemistry"
"313","26912659","Allosteric Inhibition of Bcr-Abl Kinase by High Affinity Monobody In","Bcr-Abl is a constitutively active kinase that causes chronic myelogenous leukemia. We have shown that a tandem fusion of two designed binding proteins, termed monobodies, directed to the interaction interface between the Src homology 2 (SH2) and kinase domains and to the phosphotyrosine-binding site of the SH2 domain, respectively, inhibits the Bcr-Abl kinase activity. Because the latter monobody inhibits processive phosphorylation by Bcr-Abl and the SH2-kinase interface is occluded in the active kinase, it remained undetermined whether targeting the SH2-kinase interface alone was sufficient for Bcr-Abl inhibition. To address this question, we generated new, higher affinity monobodies with single nanomolar KD values targeting the kinase-binding surface of SH2. Structural and mutagenesis studies revealed the molecular underpinnings of the monobody-SH2 interactions. Importantly, the new monobodi","Allosteric Regulation/drug effects/immunology, Antibodies, Monoclonal, Murine-Derived/*chemistry/immunology/pharmacology, Cell Line, Tumor, Fusion Proteins, bcr-abl/*antagonists & inhibitors/*chemistry/immunology/metabolism, Humans, src Homology Domains","Wojcik J, Lamontanara AJ, Grabe G, Koide A, Akin L, Gerig B, Hantschel O, Koide S","J Biol Chem. 2016 Apr 15;291(16):8836-47. doi","2016 Apr","M115.707901 [pii], 10.1074/jbc.M115.707901 [doi]","The Journal of biological chemistry"
"314","27930669","Development of RNA-FISH Assay for Detection of Oncogenic FGFR3-TACC3","INTRODUCTION AND OBJECTIVES: Oncogenic FGFR3-TACC3 fusions and FGFR3 mutations are target candidates for small molecule inhibitors in bladder cancer (BC). Because FGFR3 and TACC3 genes are located very closely on chromosome 4p16.3, detection of the fusion by DNA-FISH (fluorescent in situ hybridization) is not a feasible option. In this study, we developed a novel RNA-FISH assay using branched DNA probe to detect FGFR3-TACC3 fusions in formaldehyde-fixed paraffin-embedded (FFPE) human BC samples. MATERIALS AND METHODS: The RNA-FISH assay was developed and validated using a mouse xenograft model with human BC cell lines. Next, we assessed the consistency of the RNA-FISH assay using 104 human BC samples. In this study, primary BC tissues were stored as frozen and FFPE tissues. FGFR3-TACC3 fusions were independently detected in FFPE sections by the RNA-FISH assay and in frozen tissues by RT-PCR. We","Adult, Aged, Aged, 80 and over, Animals, Cell Line, Tumor, DNA Probes/genetics, Female, Formaldehyde, Humans, In Situ Hybridization, Fluorescence/*methods, Male, Mice, Microtubule-Associated Proteins/*genetics, Middle Aged, Neoplasm Transplantation, Oncogene Fusion/*genetics, Paraffi","Kurobe M, Kojima T, Nishimura K, Kandori S, Kawahara T, Yoshino T, Ueno S, Iizumi Y, Mitsuzuka K, Arai Y, Tsuruta H, Habuchi T, Kobayashi T, Matsui Y, Ogawa O, Sugimoto M, Kakehi Y, Nagumo Y, Tsutsumi M, Oikawa T, Kikuchi K, Nishiyama H","PLoS One. 2016 Dec 8;11(12):e0165109. doi","2016","10.1371/journal.pone.0165109 [doi], PONE-D-16-18679 [pii]","PloS one"
"315","28108151","A Functional Genetic Screen Identifies the Phosphoinositide 3-kinase","Activating mutations and translocations of the FGFR3 gene are commonly seen in urothelial cell carcinoma (UCC) of the bladder and urinary tract. Several fibroblast growth factor receptor (FGFR) inhibitors are currently in clinical development and response rates appear promising for advanced UCC. A common problem with targeted therapeutics is intrinsic or acquired resistance of the cancer cells. To find potential drug targets that can act synergistically with FGFR inhibition, we performed a synthetic lethality screen for the FGFR inhibitor AZD4547 using a short hairpin RNA library targeting the human kinome in the UCC cell line RT112 (FGFR3-TACC3 translocation). We identified multiple members of the phosphoinositide 3-kinase (PI3K) pathway and found that inhibition of PIK3CA acts synergistically with FGFR inhibitors. The PI3K inhibitor BKM120 acted synergistically with inhibition of FGFR in mult","Aminopyridines/*pharmacology, Animals, Antineoplastic Combined Chemotherapy Protocols/*pharmacology, Benzamides/*pharmacology, Carcinoma/*drug therapy/enzymology/genetics/pathology, Cell Line, Tumor, Class I Phosphatidylinositol 3-Kinases/*antagonists & inhibitors/genetics/metabolism","Wang L, Sustic T, Leite de Oliveira R, Lieftink C, Halonen P, van de Ven M, Beijersbergen RL, van den Heuvel MM, Bernards R, van der Heijden MS","Eur Urol. 2017 Jun;71(6):858-862. doi","2017 Jun","S0302-2838(17)30037-4 [pii], 10.1016/j.eururo.2017.01.021 [doi]","European urology"
"316","23669222","Detection of circulating tumor cells harboring a unique ALK rearrang","PURPOSE: The diagnostic test for ALK rearrangement in non-small-cell lung cancer (NSCLC) for crizotinib treatment is currently done on tumor biopsies or fine-needle aspirations. We evaluated whether ALK rearrangement diagnosis could be performed by using circulating tumor cells (CTCs). PATIENTS AND METHODS: The presence of an ALK rearrangement was examined in CTCs of 18 ALK-positive and 14 ALK-negative patients by using a filtration enrichment technique and filter-adapted fluorescent in situ hybridization (FA-FISH), a FISH method optimized for filters. ALK-rearrangement patterns were determined in CTCs and compared with those present in tumor biopsies. ALK-rearranged CTCs and tumor specimens were characterized for epithelial (cytokeratins, E-cadherin) and mesenchymal (vimentin, N-cadherin) marker expression. ALK-rearranged CTCs were monitored in five patients treated with crizotinib. RESULTS: A","Adult, Aged, Anaplastic Lymphoma Kinase, Cadherins/genetics/metabolism, Carcinoma, Non-Small-Cell Lung/drug therapy/*genetics/pathology, Cell Line, Tumor, Crizotinib, Female, *Gene Rearrangement, HeLa Cells, Humans, Immunohistochemistry, In Situ Hybridization, Fluorescence, Keratins/","Pailler E, Adam J, Barthelemy A, Oulhen M, Auger N, Valent A, Borget I, Planchard D, Taylor M, Andre F, Soria JC, Vielh P, Besse B, Farace F","J Clin Oncol. 2013 Jun 20;31(18):2273-81. doi","2013 Jun","JCO.2012.44.5932 [pii], 10.1200/JCO.2012.44.5932 [doi]","Journal of clinical oncology"
"317","27329306","The chimeric ubiquitin ligase SH2-U-box inhibits the growth of imati","Chronic myeloid leukemia (CML) is characterized by constitutively active fusion protein tyrosine kinase BCR-ABL. Although the tyrosine kinase inhibitor (TKI) against BCR-ABL, imatinib, is the first-line therapy for CML, acquired resistance almost inevitably emerges. The underlying mechanism are point mutations within the BCR-ABL gene, among which T315I is notorious because it resists to almost all currently available inhibitors. Here we took use of a previously generated chimeric ubiquitin ligase, SH2-U-box, in which SH2 from the adaptor protein Grb2 acts as a binding domain for activated BCR-ABL, while U-box from CHIP functions as an E3 ubiquitin ligase domain, so as to target the ubiquitination and degradation of both native and T315I-mutant BCR-ABL. As such, SH2-U-box significantly inhibited proliferation and induced apoptosis in CML cells harboring either the wild-type or T315I-mutant BCR-A","Animals, Cell Proliferation/drug effects, Drug Resistance, Neoplasm/*drug effects, Fusion Proteins, bcr-abl/*genetics, GRB2 Adaptor Protein/chemistry, Genetic Vectors/administration & dosage/pharmacology, Humans, Imatinib Mesylate/*pharmacology, K562 Cells, Lentivirus/genetics, Leuke","Ru Y, Wang Q, Liu X, Zhang M, Zhong D, Ye M, Li Y, Han H, Yao L, Li X","Sci Rep. 2016 Jun 22;6:28352. doi","2016 Jun","srep28352 [pii], 10.1038/srep28352 [doi]","Scientific reports"
"318","24674157","Sensitive and specific detection of EML4-ALK rearrangements in non-s","OBJECTIVES: Recurrent gene fusions of anaplastic lymphoma receptor tyrosine kinase (ALK) and echinoderm microtubule-associated protein-like 4 (EML4) have been recently identified in approximately 5% of non-small cell lung cancers (NSCLCs) and are targets for selective tyrosine kinase inhibitors. While fluorescent in situ hybridization (FISH) is the current gold standard for detection of EML4-ALK rearrangements, several limitations exist including high costs, time-consuming evaluation and somewhat equivocal interpretation of results. In contrast, targeted massive parallel sequencing has been introduced as a powerful method for simultaneous and sensitive detection of multiple somatic mutations even in limited biopsies, and is currently evolving as the method of choice for molecular diagnostic work-up of NSCLCs. MATERIALS AND METHODS: We developed a novel approach for indirect detection of EML4-AL","Adult, Aged, Aged, 80 and over, Carcinoma, Non-Small-Cell Lung/*genetics, Female, High-Throughput Nucleotide Sequencing/*methods, Humans, Lung Neoplasms/*genetics, Male, Middle Aged, Multiplex Polymerase Chain Reaction/methods, Oncogene Proteins, Fusion/*analysis/*genetics, Sensitivi","Moskalev EA, Frohnauer J, Merkelbach-Bruse S, Schildhaus HU, Dimmler A, Schubert T, Boltze C, Konig H, Fuchs F, Sirbu H, Rieker RJ, Agaimy A, Hartmann A, Haller F","Lung Cancer. 2014 Jun;84(3):215-21. doi","2014 Jun","S0169-5002(14)00123-8 [pii], 10.1016/j.lungcan.2014.03.002 [doi]","Lung cancer (Amsterdam, Netherlands)"
"319","28377570","Flow Cytometric Measurement of Blood Cells with BCR-ABL1 Fusion Prot","Chronic myeloid leukemia (CML) is characterized in the majority of cases by a t(9;22)(q34;q11) translocation, also called the Philadelphia chromosome, giving rise to the BCR-ABL1 fusion protein. Current treatment with tyrosine kinase inhibitors is directed against the constitutively active ABL1 domain of the fusion protein, and minimal residual disease (MRD) after therapy is monitored by real-time quantitative PCR (RQ-PCR) of the fusion transcript. Here, we describe a novel approach to detect and enumerate cells positive for the BCR-ABL1 fusion protein by combining the in situ proximity ligation assay with flow cytometry as readout (PLA-flow). By targeting of the BCR and ABL1 parts of the fusion protein with one antibody each, and creating strong fluorescent signals through rolling circle amplification, PLA-flow allowed sensitive detection of cells positive for the BCR-ABL1 fusion at frequencie","Antigens, CD34/metabolism, Biomarkers, Blood Cells/*metabolism/pathology, Cell Line, Tumor, *Flow Cytometry/methods, Fluorescent Antibody Technique, Fusion Proteins, bcr-abl/*genetics/metabolism, Humans, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*genetics/pathology","Lof L, Arngarden L, Olsson-Stromberg U, Siart B, Jansson M, Dahlin JS, Thorn I, Christiansson L, Hermansson M, Larsson A, Ahlstrand E, Walinder G, Soderberg O, Rosenquist R, Landegren U, Kamali-Moghaddam M","Sci Rep. 2017 Apr 4;7(1):623. doi","2017 Apr","10.1038/s41598-017-00755-y [doi], 10.1038/s41598-017-00755-y [pii]","Scientific reports"
"320","24091918","Cell-penetrating fusion peptides OD1 and OD2 interact with Bcr-Abl a","The Bcr-Abl oncoprotein is the cause of chronic myelogenous leukemia (CML). Crystal structure analysis suggests that Bcr30-63 is the core of the Bcr-Abl oligomerization interface for aberrant kinase activity; however, the precise role of other residues of Bcr1-72 excluding Bcr30-63 have not been evaluated. In this study, Bcr30-63 was named OD2 and other residues of Bcr1-72 were named OD1. Cytoplasmic transduction peptide (CTP) was used to carry molecules into cytoplasm. CTP-OD1 and CTP-OD2 fusion peptides were expressed from a cold-inducible expression system. Our results demonstrated that both fusion peptides could localize into the cytoplasm, specifically interact with the Bcr-Abl protein and further inhibit growth, induce apoptosis, and decrease the phosphorylation of Bcr-Abl in K562 cell lines. However, the viability of THP-1, a Bcr-Abl negative cell line, was unaffected. These results sugg","Apoptosis/*drug effects, Cell Proliferation/drug effects, Cell-Penetrating Peptides/isolation & purification/metabolism/*pharmacology, Enzyme Assays, Fusion Proteins, bcr-abl/*metabolism, Humans, Intracellular Space/drug effects/metabolism, K562 Cells, Protein Binding/drug effects, R","Wang HX, Xiao H, Zhong L, Tao K, Li YJ, Huang SF, Wen JP, Feng WL","Mol Cell Biochem. 2014 Jan;385(1-2):311-8. doi","2014 Jan","10.1007/s11010-013-1841-1 [doi]","Molecular and cellular biochemistry"
"321","20860819","Detection of DNA fusion junctions for BCR-ABL translocations by Anch","Anchored ChromPET, a technique to capture and interrogate targeted sequences in the genome, has been developed to identify chromosomal aberrations and define breakpoints. Using this method, we could define the BCR-ABL1 translocation DNA breakpoint to a base-pair resolution in Philadelphia chromosome-positive samples. This DNA-based method is highly sensitive and can detect the fusion junction using samples from which it is hard to obtain RNA or cells where the RNA expression has been silenced.","?","Shibata Y, Malhotra A, Dutta A","Genome Med. 2010 Sep 22;2(9):70. doi","2010 Sep","gm191 [pii], 10.1186/gm191 [doi]","Genome medicine"
"322","31349760","The NEDD8-activating enzyme inhibitor MLN4924 induces DNA damage in Ph+ leukemia and sensitizes for ABL kinase inhibitors.","The BCR-ABL1 fusion gene is the driver oncogene in chronic myeloid leukemia (CML) and Philadelphia-chromosome positive (Ph+) acute lymphoblastic leukemia (ALL). The introduction of tyrosine kinase inhibitors (TKIs) targeting the ABL kinase (such as imatinib) has dramatically improved survival of CML and Ph+ ALL patients. However, primary and acquired resistance to TKIs remains a clinical challenge. Ph+ leukemia patients who achieve a complete cytogenetic (CCR) or deep molecular response (MR) (>/=4.5log reduction in BCR-ABL1 transcripts) represent long-term survivors. Thus, the fast and early eradication of leukemic cells predicts MR and is the prime clinical goal for these patients. We show here that the first-in-class inhibitor of the Nedd8-activating enzyme (NAE1) MLN4924 effectively induced caspase-dependent apoptosis in Ph+ leukemia cells, and sensitized leukemic cells for ABL tyrosine kinase inhibitors (TKI) and hydroxyurea (HU). We demonstrate that MLN4924 induced DNA damage in Ph+ leukemia cells by provoking the activation of an intra S-phase checkpoint, which was enhanced by imatinib co-treatment. The combination of MLN4924 and imatinib furthermore triggered a dramatic shift in the expression of MCL1 and NOXA. Our data offers a clear rationale to explore the clinical activity of MLN4924 (alone and in combination with ABL TKI) in Ph+ leukemia patients.","Apoptosis/drug effects, Cell Line, Tumor, Cyclopentanes/*pharmacology, DNA Damage/*drug effects, Drug Resistance, Neoplasm/*drug effects, Drug Synergism, Drug Therapy, Combination, Fusion Proteins, bcr-abl/*antagonists & inhibitors/metabolism, Humans, Imatinib Mesylate/pharmacology, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*metabolism/pathology, Myeloid Cell Leukemia Sequence 1 Protein/metabolism, Protein Kinase Inhibitors/*pharmacology, Proto-Oncogene Proteins c-bcl-2/metabolism, Pyrimidines/*pharmacology, S Phase Cell Cycle Checkpoints/drug effects, Signal Transduction/drug effects, Ubiquitin-Activating Enzymes/*antagonists & inhibitors","Bahjat M, de Wilde G, van Dam T, Maas C, Bloedjes T, Bende RJ, van Noesel CJM, Luijks DM, Eldering E, Kersten MJ, Guikema JEJ","Cell Cycle. 2019 Sep;18(18):2307-2322. doi: 10.1080/15384101.2019.1646068. Epub 2019 Jul 26.","2019 Sep","10.1080/15384101.2019.1646068","Cell cycle "
"323","31804622","The mechanism of cancer drug addiction in ALK-positive T-Cell lymphoma.","Rational new strategies are needed to treat tumors resistant to kinase inhibitors. Mechanistic studies of resistance provide fertile ground for development of new approaches. Cancer drug addiction is a paradoxical resistance phenomenon, well-described in MEK-ERK-driven solid tumors, in which drug-target overexpression promotes resistance but a toxic overdose of signaling if the inhibitor is withdrawn. This can permit prolonged control of tumors through intermittent dosing. We and others showed previously that cancer drug addiction arises also in the hematologic malignancy ALK-positive anaplastic large-cell lymphoma (ALCL) resistant to ALK-specific tyrosine kinase inhibitors (TKIs). This is driven by the overexpression of the fusion kinase NPM1-ALK, but the mechanism by which ALK overactivity drives toxicity upon TKI withdrawal remained obscure. Here we reveal the mechanism of ALK-TKI addiction in ALCL. We interrogated the well-described mechanism of MEK/ERK pathway inhibitor addiction in solid tumors and found it does not apply to ALCL. Instead, phosphoproteomics and confirmatory functional studies revealed that the STAT1 overactivation is the key mechanism of ALK-TKI addiction in ALCL. The withdrawal of TKI from addicted tumors in vitro and in vivo leads to overwhelming phospho-STAT1 activation, turning on its tumor-suppressive gene-expression program and turning off STAT3's oncogenic program. Moreover, a novel NPM1-ALK-positive ALCL PDX model showed a significant survival benefit from intermittent compared with continuous TKI dosing. In sum, we reveal for the first time the mechanism of cancer drug addiction in ALK-positive ALCL and the benefit of scheduled intermittent dosing in high-risk patient-derived tumors in vivo.","Anaplastic Lymphoma Kinase/*antagonists & inhibitors/genetics/metabolism, Antineoplastic Agents/pharmacology/therapeutic use, Cell Line, Tumor, *Drug Resistance, Neoplasm, Gene Expression Regulation, Neoplastic, Humans, Lymphoma, Large-Cell, Anaplastic/enzymology/genetics/metabolism/*physiopathology, Protein Kinase Inhibitors/*pharmacology/therapeutic use, Proteomics, STAT1 Transcription Factor/*metabolism, STAT3 Transcription Factor/genetics, *Signal Transduction","Rajan SS, Amin AD, Li L, Rolland DC, Li H, Kwon D, Kweh MF, Arumov A, Roberts ER, Yan A, Basrur V, Elenitoba-Johnson KSJ, Chen XS, Puvvada SD, Lussier YA, Bilbao D, Lim MS, Schatz JH","Oncogene. 2020 Mar;39(10):2103-2117. doi: 10.1038/s41388-019-1136-4. Epub 2019 Dec 5.","2020 Mar","10.1038/s41388-019-1136-4","Oncogene"
"324","32164629","Alteration in the sensitivity to crizotinib by Na(+)/H(+) exchanger regulatory factor 1 is dependent to its subcellular localization in ALK-positive lung cancers.","Na(+)/H(+) exchanger regulatory factor 1 (NHERF1) is an important scaffold protein participates in the modulation of a variety of intracellular signal pathways. NHERF1 was able to enhance the effects of chemo-drugs in breast and cervical cancer cells. Anaplastic lymphoma kinase (ALK) fusion mutations are validated molecules targeted therapy in lung cancers, where crizotinib can be used as the specific inhibitor to suppress tumor progression. However, due to the less frequent occurrence of ALK mutations and the complexity for factors to determine drug responses, the genes that could alter crizotinib sensitivity are unclear. METHODS: Both ALK-translocated and ALK-negative lung adenocarcinoma specimens in tissue sections were collected for immunohistochemistry. The possible mechanisms of NHERF1 and its role in the cell sensitivity to crizotinib were investigated using an ALK-positive and crizotinib-sensitive lung adenocarcinoma cell line H3122. Either a NHERF1 overexpression vector or agents for NHERF1 knockdown was used for crizotinib sensitivity measures, in association with cell viability and apoptosis assays. RESULTS: The expression level of NHERF1 in ALK-translocated NSCLC was significantly higher than that in other lung cancer tissues. NHERF1 expression in ALK positive lung cancer cells was regulated by ALK activities, and was in return able to alter the sensitivity to crizotinib. The function of NHERF1 to influence crizotinib sensitivity was depending on its subcellular distribution in cytosol instead of its nucleus localized form. CONCLUSION: Ectopically overexpressed NHERF1 could be a functional protein for consideration to suppress lung cancers. The determination of NHERF1 levels in ALK positive NSCLC tissues might be useful to predict crizotinib resistance, especially by distinguishing cytosolic or nuclear localized NHERF1 for the overexpressed molecules.","Anaplastic Lymphoma Kinase/genetics/*metabolism, Carcinoma, Non-Small-Cell Lung/drug therapy/genetics/*metabolism, Cell Line, Tumor, Cell Nucleus/metabolism, Cell Proliferation/drug effects, Cell Survival/drug effects, Crizotinib/*pharmacology, Cytosol/metabolism, Drug Resistance, Neoplasm, Gene Expression Regulation, Neoplastic/drug effects, Humans, Lung Neoplasms/drug therapy/genetics/*metabolism, Phosphoproteins/genetics/*metabolism, Sodium-Hydrogen Exchangers/genetics/*metabolism, *Up-Regulation","Yang F, Hu M, Chang S, Huang J, Si Y, Wang J, Cheng S, Jiang WG","BMC Cancer. 2020 Mar 12;20(1):202. doi: 10.1186/s12885-020-6687-9.","2020 Mar","10.1186/s12885-020-6687-9","BMC cancer"
"325","33246076","Minimal Residual Disease Monitoring Using a 3'ALK Universal Probe Assay in ALK-Positive Anaplastic Large-Cell Lymphoma: ddPCR, an Attractive Alternative Method to Real-Time Quantitative PCR.","In ALK-positive anaplastic large-cell lymphomas, positive qualitative PCR for NPM1-ALK in peripheral blood and/or bone marrow at diagnosis and during treatment are associated with a higher risk of treatment failure. Real-time quantitative PCR allows identification of very high risk patients. However, this latter technique initially designed for patients with lymphomas carrying the most frequent NPM1-ALK translocation necessitates calibration curves, limiting interlaboratory reproducibility. We designed an ALK universal quantitative PCR based on 3'ALK transcript amplification to allow the detection of all ALK fusion transcripts. We validate the absolute concordance of 3'ALK quantitative PCR results with the routine NPM1-ALK qualitative and quantitative PCR on 46 samples. The universality of ALK fusion transcript detection also was validated on TPM3-, ALO17-, and ATIC-ALK-positive samples, and the EML4-ALK-positive cell line. In addition, we show that digital droplet PCR using the 3'ALK universal probe shows highly concordant results with 3'ALK universal quantitative PCR. A major benefit of digital droplet PCR is a reduced experimental set-up compared with quantitative PCR, without generation of standard curves, leading to a reliable protocol for multilaboratory validation in multicenter clinical trials essential for this rare pathology. Our ALK universal method could be used for the screening of ALK fusion transcripts in liquid biopsy of other ALK-positive tumors, including non-small cell lung carcinomas.",NULL,"Quelen C, Grand D, Sarot E, Brugieres L, Sibon D, Pradines A, Laurent C, Brousset P, Lamant L","J Mol Diagn. 2020 Nov 24. pii: S1525-1578(20)30558-4. doi: 10.1016/j.jmoldx.2020.11.002.","2020 Nov","10.1016/j.jmoldx.2020.11.002","he Journal of molecular diagnostics : JMD"
"326","31654622","Cytotoxicity of curcumin derivatives in ALK positive non-small cell lung cancer.","Non-small cell lung cancer with ALK rearrangements can be targeted effectively with ALK inhibitors such as crizotinib. However, cancer progression typically occurs within a year as drug resistance develops. One strategy to overcome this drug resistance is to determine if novel cytotoxic agents retain the ability to kill lung cancer cells that have developed ALK inhibitor resistance. We therefore examined curcumin, a drug with anticancer properties, and 2s-generation curcumin derivatives (1-methyl-3,5-bis[(E)-4-pyridyl) methylidene]-4-piperidone (RL66) and 1-isopropyl-3,5-bis[(pyridine-3-yl) methylene]piperidin-4-one (RL118)) in lung cancer cell lines. The cytotoxicity of curcumin, RL66, and RL118 were tested in both ALK(+) lung cancer cells (H3122), crizotinib resistant ALK(+) cells (CR-H3122) and ALK(-) lung cancer cells (A549), both alone and in combination with crizotinib. ALK(+) cells were 2-3x more sensitive to RL66 and RL118 than ALK(-) cells, with the drugs' eliciting IC50 values in the range of 0.7-1muM in H3122cells. Retained cytotoxic potency of the curcumin derivatives in crizotinib resistant cells indicated that mechanisms of resistance to the two drug types are independent, with resistance to ALK inhibitors not necessarily causing cross-resistance to curcumin derivatives. This was further corroborated by drug combination analysis where the effect of the drugs in combination was consistent with Bliss additivity, consistent with independent targets for crizotinib and curcumin derivatives. Results from Western blotting showed that RL118 (2muM) inhibited p-ALK/ALK by ~50%, which was not as potent as the 90% inhibition elicited by crizotinib (0.25muM). Since this is the primary mechanism of crizotinib cytotoxicity this provides further evidence of independent mechanisms of toxicity.","Anaplastic Lymphoma Kinase/*antagonists & inhibitors/metabolism, Antineoplastic Agents/*pharmacology, Carcinoma, Non-Small-Cell Lung/*drug therapy/metabolism, Cell Line, Tumor, Cell Survival/drug effects, Crizotinib/*pharmacology, Curcumin/*analogs & derivatives/*pharmacology, Drug Resistance, Neoplasm, Drug Synergism, Humans, Lung Neoplasms/*drug therapy/metabolism, Protein Kinase Inhibitors/*pharmacology","Bland AR, Bower RL, Nimick M, Hawkins BC, Rosengren RJ, Ashton JC","Eur J Pharmacol. 2019 Dec 15;865:172749. doi: 10.1016/j.ejphar.2019.172749. Epub 2019 Oct 22.","2019 Dec","10.1016/j.ejphar.2019.172749","European journal of pharmacology"
"327","32923114","ROS1-fusion protein induces PD-L1 expression via MEK-ERK activation in non-small cell lung cancer."," Despite some of the oncogenic driver mutations that have been associated with increased expression of programmed death-ligand 1 (PD-L1), the correlation between PD-L1 expression and ROS1 fusion in NSCLC cells, especially for those with Crizotinib resistance has not been fully addressed. Materials and Methods: The expression of PD-L1 in 30 primary NSCLC tumors with/without ROS1-fusion protein was evaluated by immunohistochemical (IHC) analysis. To assess the correlation between ROS1 fusion and PD-L1 expression, we down-regulated ROS1 with RNA interference or specific inhibitor (Crizotinib) in ROS1-fusion positive NSCLC cell line HCC78; or up-regulate ROS1-fusion gene in an immortalized human bronchial epithelial cell line (HBE). Mouse xenograft models were also used to determine the effect of ROS1 expression on PD-L1 expression in vivo. Crizotinib-resistant cell line was generated for measuring the association between Crizotinib resistance and PD-L1 expression. Results: ROS1-rearrangement in primary NSCLC tumor was significantly associated with up-regulated PD-L1 expression. PD-L1 expression was significantly up-regulated in bronchial epithelial cells after forced expression of ROS1 fusion and was eliminated when HCC78 xenograft mouse models were treated with Crizotinib. We found PD-L1 expression was modulated by MEK-ERK pathway signaling in both parental and Crizotinib-resistant NSCLC cells with ROS1 fusion. Conclusions: The correlation between ROS1-fusion and PD-L1 overexpression suggested that PD-L1/PD-1 blockade could be the second-line treatment option for the Crizotinib-resistant NSCLC with ROS1 rearrangement.",NULL,"Liu Z, Zhao K, Wei S, Liu C, Zhou J, Gou Q, Wu X, Yang Z, Yang Y, Peng Y, Cheng Q, Liu L","Oncoimmunology. 2020 May 6;9(1):1758003. doi: 10.1080/2162402X.2020.1758003.","2020 May","10.1080/2162402X.2020.1758003","Oncoimmunology"
"328","31118036","Circular RNA F-circSR derived from SLC34A2-ROS1 fusion gene promotes cell migration in non-small cell lung cancer.","Cancer-associated chromosomal translocations are reported to generate oncogenic circular RNA (circRNA), contributing to tumorigenesis. The fusion gene SLC34A2-ROS1 (solute carrier family 34 member 2 and ROS proto-oncogene 1) plays an important role in non-small cell lung cancer (NSCLC) progression. However, whether SLC34A2-ROS1 gene can produce circRNA remains unknown. Here, we identified two novel circRNAs (F-circSR1 and F-circSR2) generated from SLC34A2-ROS1 fusion gene, while F-circSR1 has higher expression than F-circSR2. Functional studies through gain- and loss-of-function strategies showed that both F-circSRs promote cell migration in lung cancer cells, whereas they have little effect on cell proliferation. Using the minigene GFP reporter assay, we verified that the flanking complementary sequences with canonical splicing sites are essential for F-circSR biogenesis. Therefore, our findings demonstrate the oncogenic role of F-circSR in NSCLC and highlight its therapeutic potential.","A549 Cells, Carcinoma, Non-Small-Cell Lung/*genetics, Cell Line, Tumor, Cell Movement, Gene Expression Regulation, Neoplastic, Humans, Lung Neoplasms/*genetics, Oncogene Proteins, Fusion/*genetics, Protein-Tyrosine Kinases/genetics, Proto-Oncogene Proteins/genetics, RNA, Circular/*genetics, Sodium-Phosphate Cotransporter Proteins, Type IIb/genetics, Translocation, Genetic, Up-Regulation","Wu K, Liao X, Gong Y, He J, Zhou JK, Tan S, Pu W, Huang C, Wei YQ, Peng Y","Mol Cancer. 2019 May 22;18(1):98. doi: 10.1186/s12943-019-1028-9.","2019 May","10.1186/s12943-019-1028-9","Molecular cancer"
"329","32153174","Azo-PROTAC: Novel Light-Controlled Small-Molecule Tool for Protein Knockdown.","Reversibly altering endogenous protein levels are persistent issues. Herein, we designed photoswitchable azobenzene-proteolysis targeting chimeras (Azo-PROTACs) by including azobenzene moieties between ligands for the E3 ligase and the protein of interest. Azo-PROTACs are light-controlled small-molecule tools for protein knockdown in cells. The light-induced configuration change can switch the active state to induce protein degradation activity, which can be reversely controlled by light exposure in intact cells. We compared the protein degradation abilities of Azo-PROTACs with different configurations and linker lengths. Using the stable form with the best degradation ability against the BCR-ABL fusion and ABL proteins in myelogenous leukemia K562 cells, we showed that Azo-PROTAC combines the potent protein knockdown and facile cell uptake properties of the small-molecule PROTAC with a reversible photoswitchability, offering a promising chemical knockdown strategy based on the light-induced reversible on/off properties.","Adaptor Proteins, Signal Transducing/metabolism, Azo Compounds/chemical synthesis/*pharmacology/radiation effects, Cell Line, Tumor, Dasatinib/*analogs & derivatives/*pharmacology/radiation effects, Fusion Proteins, bcr-abl/metabolism, Humans, Lenalidomide/*analogs & derivatives/*pharmacology/radiation effects, Ligands, Proteolysis/drug effects, Stereoisomerism, Ubiquitin-Protein Ligases, Ubiquitination/drug effects, Ultraviolet Rays","Sada R, Kimura H, Fukata Y, Fukata M, Yamamoto H, Kikuchi A","Sci Signal. 2019 Nov 19;12(608). pii: 12/608/eaat9519. doi: 10.1126/scisignal.aat9519.","2019 Nov","10.1126/scisignal.aat9519","Science signaling"
"330","31311809","Targeting BCR-ABL1 in Chronic Myeloid Leukemia by PROTAC-Mediated Targeted Protein Degradation.","Although the use of ATP-competitive tyrosine kinase inhibitors of oncoprotein BCR-ABL1 has enabled durable responses in patients with chronic myeloid leukemia (CML), issues of drug resistance and residual leukemic stem cells remain. To test whether the degradation of BCR-ABL1 kinase could offer improved response, we developed a series of proteolysis-targeting chimera (PROTAC) that allosterically target BCR-ABL1 protein and recruit the E3 ligase Von Hippel-Lindau, resulting in ubiquitination and subsequent degradation of the oncogenic fusion protein. In both human CML K562 cells and murine Ba/F3 cells expressing BCR-ABL1, lead compound GMB-475 induced rapid proteasomal degradation and inhibition of downstream biomarkers, such as STAT5, and showed increased sensitivity compared with diastereomeric controls lacking degradation activity. Notably, GMB-475 inhibited the proliferation of certain clinically relevant BCR-ABL1 kinase domain point mutants and further sensitized Ba/F3 BCR-ABL1 cells to inhibition by imatinib, while demonstrating no toxicity toward Ba/F3 parental cells. Reverse phase protein array analysis suggested additional differences in levels of phosphorylated SHP2, GAB2, and SHC associated with BCR-ABL1 degradation. Importantly, GMB-475 reduced viability and increased apoptosis in primary CML CD34(+) cells, with no effect on healthy CD34(+) cells at identical concentrations. GMB-475 degraded BCR-ABL1 and reduced cell viability in primary CML stem cells. Together, these findings suggest that combined BCR-ABL1 kinase inhibition and protein degradation may represent a strategy to address BCR-ABL1-dependent drug resistance, and warrant further investigation into the eradication of persistent leukemic stem cells, which rely on neither the presence nor the activity of the BCR-ABL1 protein for survival. SIGNIFICANCE: Small-molecule-induced degradation of BCR-ABL1 in CML provides an advantage over inhibition and provides insights into CML stem cell biology. ","Animals, Apoptosis/drug effects, Cell Proliferation/drug effects, Drug Resistance, Neoplasm, Fusion Proteins, bcr-abl/*antagonists & inhibitors, Humans, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/*drug therapy/metabolism/pathology, Mice, Neoplastic Stem Cells/*drug effects/metabolism/pathology, Protein Array Analysis, Protein Kinase Inhibitors/*pharmacology, Proteolysis/*drug effects, Tumor Cells, Cultured","Burslem GM, Schultz AR, Bondeson DP, Eide CA, Savage Stevens SL, Druker BJ, Crews CM","Cancer Res. 2019 Sep 15;79(18):4744-4753. doi: 10.1158/0008-5472.CAN-19-1236. Epub 2019 Jul 16.","2019 Sep","10.1158/0008-5472.CAN-19-1236","Cancer research"
"331","32203161","Deubiquitylase USP25 prevents degradation of BCR-ABL protein and ensures proliferation of Ph-positive leukemia cells.","Fusion genes resulting from chromosomal rearrangements are frequently found in a variety of cancer cells. Some of these are known to be driver oncogenes, such as BCR-ABL in chronic myelogenous leukemia (CML). The products of such fusion genes are abnormal proteins that are ordinarily degraded in cells by a mechanism known as protein quality control. This suggests that the degradation of BCR-ABL protein is suppressed in CML cells to ensure their proliferative activity. Here, we show that ubiquitin-specific protease 25 (USP25) suppresses the degradation of BCR-ABL protein in cells harboring Philadelphia chromosome (Ph). USP25 was found proximal to BCR-ABL protein in cells. Depletion of USP25 using shRNA-mediated gene silencing increased the ubiquitylated BCR-ABL, and reduced the level of BCR-ABL protein. Accordingly, BCR-ABL-mediated signaling and cell proliferation were suppressed in BCR-ABL-positive leukemia cells by the depletion of USP25. We further found that pharmacological inhibition of USP25 induced rapid degradation of BCR-ABL protein in Ph-positive leukemia cells, regardless of their sensitivity to tyrosine kinase inhibitors. These results indicate that USP25 is a novel target for inducing the degradation of oncogenic BCR-ABL protein in Ph-positive leukemia cells. This could be an effective approach to overcome resistance to kinase inhibitors.","Cell Proliferation/drug effects, Deubiquitinating Enzymes/genetics, Drug Resistance, Neoplasm/genetics, Gene Silencing/drug effects, Genes, abl/*genetics, Humans, Jurkat Cells, K562 Cells, Leukemia, Myelogenous, Chronic, BCR-ABL Positive/drug therapy/*genetics/pathology, *Philadelphia Chromosome, Protein Kinase Inhibitors/pharmacology, Proteolysis/drug effects, RNA, Small Interfering/genetics, Ubiquitin Thiolesterase/*genetics","Shibata N, Ohoka N, Tsuji G, Demizu Y, Miyawaza K, Ui-Tei K, Akiyama T, Naito M","Oncogene. 2020 May;39(19):3867-3878. doi: 10.1038/s41388-020-1253-0. Epub 2020 Mar 12.","2020 May","10.1038/s41388-020-1253-0","Oncogene"
"332","32581241","Synergism between IL7R and CXCR4 drives BCR-ABL induced transformation in Philadelphia chromosome-positive acute lymphoblastic leukemia.","Ph(+) acute lymphoblastic leukemia (ALL) is characterized by the expression of an oncogenic fusion kinase termed BCR-ABL1. Here, we show that interleukin 7 receptor (IL7R) interacts with the chemokine receptor CXCR4 to recruit BCR-ABL1 and JAK kinases in close proximity. Treatment with BCR-ABL1 kinase inhibitors results in elevated expression of IL7R which enables the survival of transformed cells when IL7 was added together with the kinase inhibitors. Importantly, treatment with anti-IL7R antibodies prevents leukemia development in xenotransplantation models using patient-derived Ph(+) ALL cells. Our results suggest that the association between IL7R and CXCR4 serves as molecular platform for BCR-ABL1-induced transformation and development of Ph(+) ALL. Targeting this platform with anti-IL7R antibody eliminates Ph(+) ALL cells including those with resistance to commonly used ABL1 kinase inhibitors. Thus, anti-IL7R antibodies may provide alternative treatment options for ALL in general and may suppress incurable drug-resistant leukemia forms.","Animals, Cell Line, Tumor, Cell Transformation, Neoplastic/drug effects, Female, Forkhead Box Protein O1/metabolism, Fusion Proteins, bcr-abl/antagonists & inhibitors/genetics/*metabolism, Gene Expression Regulation, Neoplastic/drug effects, Humans, Interleukin-7/pharmacology, Interleukin-7 Receptor alpha Subunit/antagonists & inhibitors/genetics/*metabolism, Mice, Mice, Mutant Strains, *Philadelphia Chromosome, Precursor Cell Lymphoblastic Leukemia-Lymphoma/genetics/metabolism/*pathology, Protein Kinase Inhibitors/pharmacology, Receptors, CXCR4/genetics/*metabolism, Signal Transduction/drug effects","Abdelrasoul H, Vadakumchery A, Werner M, Lenk L, Khadour A, Young M, El Ayoubi O, Vogiatzi F, Kramer M, Schmid V, Chen Z, Yousafzai Y, Cario G, Schrappe M, Muschen M, Halsey C, Mulaw MA, Schewe DM, Hobeika E, Alsadeq A, Jumaa H","Nat Commun. 2020 Jun 24;11(1):3194. doi: 10.1038/s41467-020-16927-w.","2020 Jun","10.1038/s41467-020-16927-w","Nature communications"
"333","32315352","INCB054828 (pemigatinib), a potent and selective inhibitor of fibroblast growth factor receptors 1, 2, and 3, displays activity against genetically defined tumor models.","Alterations in fibroblast growth factor receptor (FGFR) genes have been identified as potential driver oncogenes. Pharmacological targeting of FGFRs may therefore provide therapeutic benefit to selected cancer patients, and proof-of-concept has been established in early clinical trials of FGFR inhibitors. Here, we present the molecular structure and preclinical characterization of INCB054828 (pemigatinib), a novel, selective inhibitor of FGFR 1, 2, and 3, currently in phase 2 clinical trials. INCB054828 pharmacokinetics and pharmacodynamics were investigated using cell lines and tumor models, and the antitumor effect of oral INCB054828 was investigated using xenograft tumor models with genetic alterations in FGFR1, 2, or 3. Enzymatic assays with recombinant human FGFR kinases showed potent inhibition of FGFR1, 2, and 3 by INCB054828 (half maximal inhibitory concentration [IC50] 0.4, 0.5, and 1.0 nM, respectively) with weaker activity against FGFR4 (IC50 30 nM). INCB054828 selectively inhibited growth of tumor cell lines with activation of FGFR signaling compared with cell lines lacking FGFR aberrations. The preclinical pharmacokinetic profile suggests target inhibition is achievable by INCB054828 in vivo with low oral doses. INCB054828 suppressed the growth of xenografted tumor models with FGFR1, 2, or 3 alterations as monotherapy, and the combination of INCB054828 with cisplatin provided significant benefit over either single agent, with an acceptable tolerability. The preclinical data presented for INCB054828, together with preliminary clinical observations, support continued investigation in patients with FGFR alterations, such as fusions and activating mutations.","Administration, Oral, Animals, Cell Line, Tumor, Female, Half-Life, Humans, Mice, Mice, Inbred C57BL, Mice, Nude, Mice, SCID, Morpholines/chemistry/pharmacokinetics/*therapeutic use, Neoplasms/*drug therapy/pathology, Protein Kinase Inhibitors/chemistry/pharmacokinetics/*therapeutic use, Pyrimidines/chemistry/pharmacokinetics/*therapeutic use, Pyrroles/chemistry/pharmacokinetics/*therapeutic use, Rats, Rats, Nude, Receptor, Fibroblast Growth Factor, Type 1/*antagonists & inhibitors/metabolism, Receptor, Fibroblast Growth Factor, Type 2/*antagonists & inhibitors/metabolism, Receptor, Fibroblast Growth Factor, Type 3/*antagonists & inhibitors/metabolism, Xenograft Model Antitumor Assays","Liu PCC, Koblish H, Wu L, Bowman K, Diamond S, DiMatteo D, Zhang Y, Hansbury M, Rupar M, Wen X, Collier P, Feldman P, Klabe R, Burke KA, Soloviev M, Gardiner C, He X, Volgina A, Covington M, Ruggeri B, Wynn R, Burn TC, Scherle P, Yeleswaram S, Yao W, Huber R, Hollis G","PLoS One. 2020 Apr 21;15(4):e0231877. doi: 10.1371/journal.pone.0231877. eCollection 2020.","2020","10.1371/journal.pone.023187","PloS one"
"334","32193476","Recombinant expression, characterization, and quantification in human cancer cell lines of the Anaplastic Large-Cell Lymphoma-characteristic NPM-ALK fusion protein.","Systemic anaplastic large cell lymphoma (ALCL) is an aggressive T-cell lymphoma most commonly seen in children and young adults. The majority of pediatric ALCLs are associated with the t(2;5)(p23;q35) translocation which fuses the Anaplastic Lymphoma Kinase (ALK) gene with the Nucleophosmin (NPM) gene. The NPM-ALK fusion protein is a constitutively-active tyrosine kinase, and plays a major role in tumor pathogenesis. In an effort to advance novel diagnostic approaches and the understanding of the function of this fusion protein in cancer cells, we expressed in E. coli, purified and characterized human NPM-ALK fusion protein to be used as a standard for estimating expression levels in cultured human ALCL cells, a key tool in ALCL pathobiology research. We estimated that NPM-ALK fusion protein is expressed at substantial levels in both Karpas 299 and SU-DHL-1 cells (ca. 4-6 million molecules or 0.5-0.7 pg protein per cell; based on our in-house developed NPM-ALK ELISA; LOD of 40 pM) as compared to the ubiquitous beta-actin protein (ca. 64 million molecules or 4.5 pg per lymphocyte). We also compared NPM-ALK/ beta-actin ratios determined by ELISA to those independently determined by two-dimensional electrophoresis and showed that the two methods are in good agreement.","Actins/genetics/metabolism, Adolescent, Cell Line, Tumor, Child, Electrophoresis, Gel, Two-Dimensional, Enzyme-Linked Immunosorbent Assay, *Gene Expression, Humans, Lymphoma, Large-Cell, Anaplastic/*genetics, Protein-Tyrosine Kinases/*genetics/*metabolism/physiology, Recombination, Genetic/*genetics, Translocation, Genetic/genetics, Young Adult","Kourentzi K, Crum M, Patil U, Prebisch A, Chavan D, Vu B, Zeng Z, Litvinov D, Zu Y, Willson RC","Sci Rep. 2020 Mar 19;10(1):5078. doi: 10.1038/s41598-020-61936-w.","2020 Mar","10.1038/s41598-020-61936-w","Scientific reports"
"335","33140567","The novel ALK inhibitor ZX-29 induces apoptosis through inhibiting ALK and inducing ROS-mediated endoplasmic reticulum stress in Karpas299 cells.","It is a well-known fact that 60%-85% of anaplastic large cell lymphoma (ALCL) is mainly driven by the anaplastic lymphoma kinase (ALK) fusion protein. Although ALK-positive ALCL patients respond significantly to ALK inhibitors, the development of resistance is inevitable, which requires the development of new therapeutic strategies for ALK-positive ALCL. Here, we investigated the anticancer activities of N-(2((5-chloro-2-((2-methoxy-6-(4-methylpiperazin-1-yl)pyridin-3yl)amino)pyrimidi n-4-yl)amino)phenyl)methanesulfonamide (ZX-29), a newly synthesized ALK inhibitor, against nucleophosmin-ALK-positive cell line Karpas299. We demonstrated that ZX-29 decreased Karpas299 cells growth and had better cytotoxicity than ceritinib, which was mediated through downregulating the expression of ALK and related proteins, inducing cell cycle arrest, and promoting cell apoptosis. Moreover, ZX-29-induced cell apoptosis by inducing endoplasmic reticulum stress (ERS). In addition, ZX-29 increased the generation of reactive oxygen species (ROS), and cells pretreatment with N-acetyl- l-cysteine could attenuate ZX-29-induced cell apoptosis and ERS. Taken together, ZX-29 inhibited Karpas299 cell proliferation and induced apoptosis through inhibiting ALK and its downstream protein expression and inducing ROS-mediated ERS. Therefore, our results provide evidence for a novel antitumor candidate for the further investigation.",NULL,"Zhou X, Zhang X, Wu Z, Xu X, Guo M, Zhai X, Zuo D, Wu Y","J Biochem Mol Toxicol. 2020 Nov 2:e22666. doi: 10.1002/jbt.22666.","2020 Nov","10.1002/jbt.22666","Journal of biochemical and molecular toxicology"
"336","30262555","miR-497 suppresses cycle progression through an axis involving CDK6 in ALK-positive cells.","Anaplastic large-cell lymphoma, a T-cell neoplasm, is primarily a pediatric disease. Seventy-five percent of pediatric anaplastic large-cell lymphoma cases harbor the chromosomal translocation t(2;5)(p23;q35) leading to the ectopic expression of NPM-ALK, a chimeric tyrosine kinase. NPM-ALK consists of an N-terminal nucleophosmin (NPM) domain fused to an anaplastic lymphoma kinase (ALK) cytoplasmic domain. Pediatric NPM-ALK(+) anaplastic large-cell lymphoma is often a disseminated disease and young patients are prone to chemoresistance or relapse shortly after chemotherapeutic treatment. Furthermore, there is no gold standard protocol for the treatment of relapses. To the best of our knowledge, this is the first study on the potential role of the microRNA, miR-497, in NPM-ALK(+) anaplastic large-cell lymphoma tumorigenesis. Our results show that miR-497 expression is repressed in NPM-ALK(+) cell lines and patient samples through the hypermethylation of its promoter and the activity of NPM-ALK is responsible for this epigenetic repression. We demonstrate that overexpression of miR-497 in human NPM-ALK(+) anaplastic large-cell lymphoma cells inhibits cellular growth and causes cell cycle arrest by targeting CDK6, E2F3 and CCNE1, the three regulators of the G1 phase of the cell cycle. Interestingly, we show that a scoring system based on CDK6, E2F3 and CCNE1 expression could help to identify relapsing pediatric patients. In addition, we demonstrate the sensitivity of NPM-ALK(+) cells to CDK4/6 inhibition using for the first time a selective inhibitor, palbociclib. Together, our findings suggest that CDK6 could be a therapeutic target for the development of future treatments for NPM-ALK(+) anaplastic large-cell lymphoma.","Anaplastic Lymphoma Kinase/genetics/*metabolism, Animals, Apoptosis/genetics, Cell Cycle/*genetics, Cell Line, Tumor, Cell Proliferation, Cyclin-Dependent Kinase 6/genetics/*metabolism, DNA Methylation, Female, Gene Expression Regulation, Neoplastic, Heterografts, Humans, Lymphoma, Large-Cell, Anaplastic/genetics/metabolism/pathology, Mice, MicroRNAs/*genetics, Models, Biological, Multigene Family, Signal Transduction","Hoareau-Aveilla C, Quelen C, Congras A, Caillet N, Labourdette D, Dozier C, Brousset P, Lamant L, Meggetto F","Haematologica. 2019 Feb;104(2):347-359. doi: 10.3324/haematol.2018.195131. Epub 2018 Sep 27.","2019 Feb","10.3324/haematol.2018.195131","Haematologica"
"337","32020234","Identification of anaplastic lymphoma kinase fusions in clear cell renal cell carcinoma.","As one of the most common types of renal cancer, clear cell renal cell carcinoma (ccRCC) in advanced stages constitutes a continued major challenge for urooncologists, as the identification of novel driver mutations and the development of novel targeted therapies against them remain an unmet need. Aberrations in anaplastic lymphoma kinase (ALK), a rational therapeutic target, as verified in lung cancer with ALK rearrangement, have been implicated in the pathogenesis of multiple human cancers. In the present study, we screened ALK expression in 87 pathologically defined ccRCCs via immunohistochemistry (IHC) using a newly developed rabbit antihuman ALK monoclonal antibody (clone D5F3). Four patients tested positive for ALK expression, as confirmed by IHC. Among them, 2 patients were further confirmed with fluorescence in situ hybridization (FISH) assay with the use of the Vysis LSI ALK dual color breakapart probe. Furthermore, we detected the existence of the echinoderm microtubuleassociated proteinlike 4/anaplastic lymphoma kinase (EML4ALK) (E13:A20, variant 1) fusion gene in tumors from these two patients by using rapid amplification of cDNA ends (RACE)coupled PCR sequencing and RTPCR. Notably, we first showed that enforced EML4ALK expression could significantly promote in vitro proliferation, clonogenic colony formation and apoptosis resistance in HK2 immortalized normal renal tubal epithelial cells and their in vivo outgrowth when injected into immunocompromised nude mice. Importantly, this protumorigenic effect was completely abolished by the ALKspecific inhibitor crizotinib, indicating the potential effectiveness of ALKspecific inhibitors in treating ALKrearranged ccRCC patients. Our data revealed that ALK fusions exist in adult ccRCC, providing a rationale for ALK inhibitor therapy in selected patients with ccRCC.","Adult, Aged, Anaplastic Lymphoma Kinase/antagonists & inhibitors/*genetics, Animals, Carcinogenesis/*genetics, Carcinoma, Renal Cell/drug therapy/*genetics/pathology, Cell Line, Tumor, Female, Gene Rearrangement/genetics, Heterografts, Humans, In Situ Hybridization, Fluorescence, Male, Mice, Middle Aged, Oncogene Proteins, Fusion/antagonists & inhibitors/*genetics","Chen W, Li W, Bai B, Wei H","Oncol Rep. 2020 Mar;43(3):817-826. doi: 10.3892/or.2020.7462. Epub 2020 Jan 14.","2020 Mar","10.3892/or.2020.7462","Oncology reports"
"338","32596809","1-(4-((5-chloro-4-((2-(isopropylsulfonyl)phenyl)amino)pyrimidin-2-yl)amino)-3-met hoxyphenyl)-3-(2-(dimethylamino)ethyl)imidazolidin-2-one (ZX-42), a novel ALK inhibitor, induces apoptosis and protective autophagy in H2228 cells.","o examine the antiproliferative effects of 1-(4-((5-chloro-4-((2-(isopropylsulfonyl)phenyl)amino)pyrimidin-2-yl)amino)-3-met hoxyphenyl)-3-(2-(dimethylamino)ethyl)imidazolidin-2-one (ZX-42) on the echinoderm microtubule-associated protein-4/anaplastic lymphoma kinase fusion gene (EML4-ALK) positive lung cancer cell line H2228 and its underlying mechanism. METHODS: The MTT assay was used to study the effect of ZX-42 on H2228 cell growth. Propidium iodide (PI) staining and Western blotting were used to investigate the cell cycle changes. ZX-42-induced cell apoptosis was determined using the Annexin V-FITC/PI (AV/PI) apoptotic assay kit, acridine orange/ethidium bromide (AO/EB) and Hoechst 33258 staining, Rhodamine 123 (Rh 123) fluorescence assay and Western blotting. ZX-42-induced reactive oxygen species (ROS) production was examined by ROS assay kit. Transmission electron microscope, monodansylcadaverine (MDC) staining and the AV/PI apoptotic assay kit were used to demonstrate the relationship between autophagy and apoptosis. KEY FINDINGS: ZX-42 had good cell viability inhibitory effect on H2228 cells. ZX-42 dramatically inhibited ALK and its downstream pathways. ZX-42 also blocked H2228 cell cycle at G1 phase and then induced apoptosis by activating the mitochondrial pathway. Next, ZX-42 induced the production of ROS, and antioxidant N-acetylcysteine (NAC) reduced ROS production and also decreased apoptotic rates. We also found that ZX-42 induced protective autophagy in H2228 cells.",NULL,"Wang L, Xu X, Liu T, Wang J, Shen J, Guo M, Wu Y, Zhai X, Zuo ","J Pharm Pharmacol. 2020 Oct;72(10):1370-1382. doi: 10.1111/jphp.13315. Epub 2020 Jun 28.","2020 Oct","10.1111/jphp.13315","The Journal of pharmacy and pharmacology"
"339","33271368","Development and Validation of an RNA Sequencing Assay for Gene Fusion Detection in Formalin-Fixed, Paraffin-Embedded Tumors.","NA sequencing (RNA-seq) is a well-validated tool for detecting gene fusions in fresh frozen tumors; however, RNA-seq is much more challenging to use with formalin-fixed, paraffin-embedded (FFPE) tumor samples. We evaluated the performance of RNA-seq to detect gene fusions in clinical FFPE tumor samples. Our assay identified all 15 spiked-in NTRK fusions from RNA reference material and six known fusions from five cancer cell lines. Limit of detection for the assay was assessed with a series of dilutions of RNA from the cell line H2228. These fusions can be detected when the dilution is down to 10%. Good intra-assay and interassay reproducibility was observed in three specimens. For clinical validation, the assay detected 10 of 12 fusions initially identified by a DNA panel (covering 23 gene fusions) in clinical specimens (83.3% sensitivity), whereas one fusion (MET fusion) was identified in another 34 fusion-negative tumor specimens as determined by the DNA panel (negative prediction value of 94.3%). This MET fusion was confirmed by RT-PCR and Sanger sequencing, which found that this is a false-negative result for the DNA panel. The assay also identified 26 extra fusions not covered by the DNA panel, 20 (76.9%) of which were validated by RT-PCR and Sanger sequencing. Therefore, this RNA assay has reasonable performance and could complement DNA-based next-generation sequencing assays.",NULL,"Peng H, Huang R, Wang K, Wang C, Li B, Guo Y, Li M, Zhang D, Dong H, Chen H, Chen C, Xu Q, Li F, Tian L, Wu J","J Mol Diagn. 2020 Nov 30. pii: S1525-1578(20)30579-1. doi: 10.1016/j.jmoldx.2020.11.005.","2020 Nov","10.1016/j.jmoldx.2020.11.005","The Journal of molecular diagnostics : JMD"
"340","31987043","FGFR3 signaling and function in triple negative breast cancer.","Triple negative breast cancer (TNBC) accounts for 16% of breast cancers and represents an aggressive subtype that lacks targeted therapeutic options. In this study, mass spectrometry (MS)-based tyrosine phosphorylation profiling identified aberrant FGFR3 activation in a subset of TNBC cell lines. This kinase was therefore evaluated as a potential therapeutic target. METHODS: MS-based tyrosine phosphorylation profiling was undertaken across a panel of 24 TNBC cell lines. Immunoprecipitation and Western blot were used to further characterize FGFR3 phosphorylation. Indirect immunofluorescence and confocal microscopy were used to determine FGFR3 localization. The selective FGFR1-3 inhibitor, PD173074 and siRNA knockdowns were used to characterize the functional role of FGFR3 in vitro. The TCGA and Metabric breast cancer datasets were interrogated to identify FGFR3 alterations and how they relate to breast cancer subtype and overall patient survival. RESULTS: High FGFR3 expression and phosphorylation were detected in SUM185PE cells, which harbor a FGFR3-TACC3 gene fusion. Low FGFR3 phosphorylation was detected in CAL51, MFM-223 and MDA-MB-231 cells. In SUM185PE cells, the FGFR3-TACC3 fusion protein contributed the majority of phosphorylated FGFR3, and largely localized to the cytoplasm and plasma membrane, with staining at the mitotic spindle in a small subset of cells. Knockdown of the FGFR3-TACC3 fusion and wildtype FGFR3 in SUM185PE cells decreased FRS2, AKT and ERK phosphorylation, and induced cell death. Knockdown of wildtype FGFR3 resulted in only a trend for decreased proliferation. PD173074 significantly decreased FRS2, AKT and ERK activation, and reduced SUM185PE cell proliferation. Cyclin A and pRb were also decreased in the presence of PD173074, while cleaved PARP was increased, indicating cell cycle arrest in G1 phase and apoptosis. Knockdown of FGFR3 in CAL51, MFM-223 and MDA-MB-231 cells had no significant effect on cell proliferation. Interrogation of public datasets revealed that increased FGFR3 expression in breast cancer was significantly associated with reduced overall survival, and that potentially oncogenic FGFR3 alterations (eg mutation and amplification) occur in the TNBC/basal, luminal A and luminal B subtypes, but are rare. CONCLUSIONS: These results indicate that targeting FGFR3 may represent a therapeutic option for TNBC, but only for patients with oncogenic FGFR3 alterations, such as the FGFR3-TACC3 fusion. Video abstract.","Cell Line, Tumor, Cell Proliferation, Female, G1 Phase Cell Cycle Checkpoints, Humans, Microtubule-Associated Proteins/genetics/metabolism, Phosphorylation, Receptor, Fibroblast Growth Factor, Type 3/genetics/*metabolism, Signal Transduction, Triple Negative Breast Neoplasms/genetics/*metabolism/physiopathology","Chew NJ, Nguyen EV, Su SP, Novy K, Chan HC, Nguyen LK, Luu J, Simpson KJ, Lee RS, Daly RJ","Cell Commun Signal. 2020 Jan 27;18(1):13. doi: 10.1186/s12964-019-0486-4.","2020 Jan","10.1186/s12964-019-0486-4","Cell communication and signaling : CCS"
"341","22101766","Functionally recurrent rearrangements of the MAST kinase and Notch gene families in breast cancer","Breast cancer is a heterogeneous disease that has a wide range of molecular aberrations and clinical outcomes. Here we used paired-end transcriptome sequencing to explore the landscape of gene fusions in a panel of breast cancer cell lines and tissues. We observed that individual breast cancers have a variety of expressed gene fusions. We identified two classes of recurrent gene rearrangements involving genes encoding microtubule-associated serine-threonine kinase (MAST) and members of the Notch family. Both MAST and Notch-family gene fusions have substantial phenotypic effects in breast epithelial cells. Breast cancer cell lines harboring Notch gene rearrangements are uniquely sensitive to inhibition of Notch signaling, and overexpression of MAST1 or MAST2 gene fusions has a proliferative effect both in vitro and in vivo. These findings show that recurrent gene rearrangements have key roles in subsets of carcinomas and suggest that transcriptome sequencing could identify individuals with rare, targetable gene fusions.","Alleles, Animals, Breast Neoplasms / genetics*, Carcinoma / genetics, Cell Line, Tumor, Cell Proliferation, Disease Models, Animal, Female, Gene Expression Regulation, Neoplastic, Gene Fusion, Gene Rearrangement*, Humans, Mice, Mice, SCID, Microtubule-Associated Proteins / genetics*, Microtubule-Associated Proteins / metabolism, Microtubules, Multigene Family, Protein-Serine-Threonine Kinases / genetics*, Protein-Serine-Threonine Kinases / metabolism, Receptor, Notch1 / genetics, Receptor, Notch1 / metabolism, Receptor, Notch2 / genetics, Receptor, Notch2 / metabolism, Receptors, Notch / genetics*, Receptors, Notch / metabolism, Signal Transduction, Transcriptome","Robinson DR, Kalyana-Sundaram S, Wu YM, Shankar S, Cao X, Ateeq B, Asangani IA, Iyer M, Maher CA, Grasso CS, Lonigro RJ, Quist M, Siddiqui J, Mehra R, Jing X, Giordano TJ, Sabel MS, Kleer CG, Palanisamy N, Natrajan R, Lambros MB, Reis-Filho JS, Kumar-Sinha C, Chinnaiyan AM","Nat Med. 2011 Nov 20;17(12):1646-51. doi: 10.1038/nm.2580.","2011 Nov","10.1038/nm.2580","Nature medicine"
"342","22952423","Gene fusions associated with recurrent amplicons represent a class of passenger aberrations in breast cancer","Application of high-throughput transcriptome sequencing has spurred highly sensitive detection and discovery of gene fusions in cancer, but distinguishing potentially oncogenic fusions from random, ""passenger"" aberrations has proven challenging. Here we examine a distinctive group of gene fusions that involve genes present in the loci of chromosomal amplifications--a class of oncogenic aberrations that are widely prevalent in breast cancers. Integrative analysis of a panel of 14 breast cancer cell lines comparing gene fusions discovered by high-throughput transcriptome sequencing and genome-wide copy number aberrations assessed by array comparative genomic hybridization, led to the identification of 77 gene fusions, of which more than 60% were localized to amplicons including 17q12, 17q23, 20q13, chr8q, and others. Many of these fusions appeared to be recurrent or involved highly expressed oncogenic drivers, frequently fused with multiple different partners, but sometimes displaying loss of functional domains. As illustrative examples of the ""amplicon-associated"" gene fusions, we examined here a recurrent gene fusion involving the mediator of mammalian target of rapamycin signaling, RPS6KB1 kinase in BT-474, and the therapeutically important receptor tyrosine kinase EGFR in MDA-MB-468 breast cancer cell line. These gene fusions comprise a minor allelic fraction relative to the highly expressed full-length transcripts and encode chimera lacking the kinase domains, which do not impart dependence on the respective cells. Our study suggests that amplicon-associated gene fusions in breast cancer primarily represent a by-product of chromosomal amplifications, which constitutes a subset of passenger aberrations and should be factored accordingly during prioritization of gene fusion candidates.","Base Sequence, Breast Neoplasms / genetics*, Cell Line, Tumor, Chromosome Mapping, Comparative Genomic Hybridization, DNA Copy Number Variations, ErbB Receptors / genetics*, Female, Gene Amplification*, Gene Dosage, Gene Expression Profiling, Gene Fusion*, Humans, Oligonucleotide Array Sequence Analysis, RNA Interference, RNA, Small Interfering, Ribosomal Protein S6 Kinases, 70-kDa / genetics*, Sequence Analysis, DNA","Kalyana-Sundaram S, Shankar S, Deroo S, Iyer MK, Palanisamy N, Chinnaiyan AM, Kumar-Sinha C","Neoplasia. 2012 Aug;14(8):702-8. doi: 10.1593/neo.12914.","2012 Aug","10.1593/neo.12914","Neoplasia"